ID: 1022540328

View in Genome Browser
Species Human (GRCh38)
Location 7:31128957-31128979
Sequence CTGTGGAGAAAAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022540328_1022540336 1 Left 1022540328 7:31128957-31128979 CCCTCCTCCCTTTTTCTCCACAG No data
Right 1022540336 7:31128981-31129003 TTCATTTGAGAGTGGGATTCAGG No data
1022540328_1022540335 -6 Left 1022540328 7:31128957-31128979 CCCTCCTCCCTTTTTCTCCACAG No data
Right 1022540335 7:31128974-31128996 CCACAGCTTCATTTGAGAGTGGG No data
1022540328_1022540333 -7 Left 1022540328 7:31128957-31128979 CCCTCCTCCCTTTTTCTCCACAG No data
Right 1022540333 7:31128973-31128995 TCCACAGCTTCATTTGAGAGTGG No data
1022540328_1022540337 4 Left 1022540328 7:31128957-31128979 CCCTCCTCCCTTTTTCTCCACAG No data
Right 1022540337 7:31128984-31129006 ATTTGAGAGTGGGATTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022540328 Original CRISPR CTGTGGAGAAAAAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr