ID: 1022540897

View in Genome Browser
Species Human (GRCh38)
Location 7:31134687-31134709
Sequence GCTCCACGGGCCCAGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022540888_1022540897 20 Left 1022540888 7:31134644-31134666 CCACTAGATGGCACTAGATGTTC No data
Right 1022540897 7:31134687-31134709 GCTCCACGGGCCCAGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022540897 Original CRISPR GCTCCACGGGCCCAGGGCGA GGG Intergenic
No off target data available for this crispr