ID: 1022547325

View in Genome Browser
Species Human (GRCh38)
Location 7:31201230-31201252
Sequence CCTCTTCAAATTTCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022547325_1022547329 11 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547329 7:31201264-31201286 ACCATTTACAAAGGTAGAGCAGG No data
1022547325_1022547332 17 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547332 7:31201270-31201292 TACAAAGGTAGAGCAGGGATAGG No data
1022547325_1022547328 2 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547328 7:31201255-31201277 TTGTATAGGACCATTTACAAAGG No data
1022547325_1022547333 29 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547333 7:31201282-31201304 GCAGGGATAGGAAAACTTCAAGG No data
1022547325_1022547334 30 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547334 7:31201283-31201305 CAGGGATAGGAAAACTTCAAGGG No data
1022547325_1022547331 12 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547331 7:31201265-31201287 CCATTTACAAAGGTAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022547325 Original CRISPR CCTCTTCAAATTTCCCAGTG TGG (reversed) Intergenic
No off target data available for this crispr