ID: 1022547331

View in Genome Browser
Species Human (GRCh38)
Location 7:31201265-31201287
Sequence CCATTTACAAAGGTAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022547325_1022547331 12 Left 1022547325 7:31201230-31201252 CCACACTGGGAAATTTGAAGAGG No data
Right 1022547331 7:31201265-31201287 CCATTTACAAAGGTAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022547331 Original CRISPR CCATTTACAAAGGTAGAGCA GGG Intergenic
No off target data available for this crispr