ID: 1022547486

View in Genome Browser
Species Human (GRCh38)
Location 7:31202299-31202321
Sequence AGAGAATCAAGGCTACTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022547480_1022547486 -4 Left 1022547480 7:31202280-31202302 CCACCAAGTTTGAGGGACCAGAG No data
Right 1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG No data
1022547481_1022547486 -7 Left 1022547481 7:31202283-31202305 CCAAGTTTGAGGGACCAGAGAAT No data
Right 1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG No data
1022547477_1022547486 8 Left 1022547477 7:31202268-31202290 CCAATTTTAGAGCCACCAAGTTT No data
Right 1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG No data
1022547476_1022547486 9 Left 1022547476 7:31202267-31202289 CCCAATTTTAGAGCCACCAAGTT No data
Right 1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG No data
1022547475_1022547486 18 Left 1022547475 7:31202258-31202280 CCAAAGGTTCCCAATTTTAGAGC No data
Right 1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022547486 Original CRISPR AGAGAATCAAGGCTACTGTG GGG Intergenic
No off target data available for this crispr