ID: 1022548602

View in Genome Browser
Species Human (GRCh38)
Location 7:31213242-31213264
Sequence GATGAATTCAACCTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022548596_1022548602 11 Left 1022548596 7:31213208-31213230 CCCAGTCTTGGTACAAAGCAGGC No data
Right 1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG No data
1022548597_1022548602 10 Left 1022548597 7:31213209-31213231 CCAGTCTTGGTACAAAGCAGGCA No data
Right 1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG No data
1022548593_1022548602 22 Left 1022548593 7:31213197-31213219 CCCATCACACTCCCAGTCTTGGT No data
Right 1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG No data
1022548591_1022548602 28 Left 1022548591 7:31213191-31213213 CCACGTCCCATCACACTCCCAGT No data
Right 1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG No data
1022548594_1022548602 21 Left 1022548594 7:31213198-31213220 CCATCACACTCCCAGTCTTGGTA No data
Right 1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022548602 Original CRISPR GATGAATTCAACCTGGATTC AGG Intergenic
No off target data available for this crispr