ID: 1022551331

View in Genome Browser
Species Human (GRCh38)
Location 7:31242268-31242290
Sequence CAGCATCTGCATCTTTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022551331_1022551334 13 Left 1022551331 7:31242268-31242290 CCAACCAAAAGATGCAGATGCTG No data
Right 1022551334 7:31242304-31242326 TGCTATATTGCACACTGAAATGG No data
1022551331_1022551335 18 Left 1022551331 7:31242268-31242290 CCAACCAAAAGATGCAGATGCTG No data
Right 1022551335 7:31242309-31242331 TATTGCACACTGAAATGGTAAGG No data
1022551331_1022551336 22 Left 1022551331 7:31242268-31242290 CCAACCAAAAGATGCAGATGCTG No data
Right 1022551336 7:31242313-31242335 GCACACTGAAATGGTAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022551331 Original CRISPR CAGCATCTGCATCTTTTGGT TGG (reversed) Intergenic
No off target data available for this crispr