ID: 1022552515

View in Genome Browser
Species Human (GRCh38)
Location 7:31254703-31254725
Sequence GAGAGTTCCCAGAACTGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022552515_1022552516 0 Left 1022552515 7:31254703-31254725 CCGTGACAGTTCTGGGAACTCTC No data
Right 1022552516 7:31254726-31254748 GTATTTGTTATAAAAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022552515 Original CRISPR GAGAGTTCCCAGAACTGTCA CGG (reversed) Intergenic
No off target data available for this crispr