ID: 1022552568

View in Genome Browser
Species Human (GRCh38)
Location 7:31255163-31255185
Sequence GTCTCTAGGGGGTTTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022552568_1022552579 29 Left 1022552568 7:31255163-31255185 CCAGAGAGAAACCCCCTAGAGAC No data
Right 1022552579 7:31255215-31255237 AATGCTAAAGCAATATTCTTTGG No data
1022552568_1022552573 -5 Left 1022552568 7:31255163-31255185 CCAGAGAGAAACCCCCTAGAGAC No data
Right 1022552573 7:31255181-31255203 GAGACCATTACTCCTCCTTATGG No data
1022552568_1022552576 6 Left 1022552568 7:31255163-31255185 CCAGAGAGAAACCCCCTAGAGAC No data
Right 1022552576 7:31255192-31255214 TCCTCCTTATGGGAGTCTTATGG No data
1022552568_1022552574 -4 Left 1022552568 7:31255163-31255185 CCAGAGAGAAACCCCCTAGAGAC No data
Right 1022552574 7:31255182-31255204 AGACCATTACTCCTCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022552568 Original CRISPR GTCTCTAGGGGGTTTCTCTC TGG (reversed) Intergenic
No off target data available for this crispr