ID: 1022557762

View in Genome Browser
Species Human (GRCh38)
Location 7:31316878-31316900
Sequence AGTAGAGGGTTCAGGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022557757_1022557762 3 Left 1022557757 7:31316852-31316874 CCTCTGGGGCTGCACCTTCATAT No data
Right 1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG No data
1022557756_1022557762 6 Left 1022557756 7:31316849-31316871 CCACCTCTGGGGCTGCACCTTCA No data
Right 1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG No data
1022557751_1022557762 18 Left 1022557751 7:31316837-31316859 CCTATGATAACCCCACCTCTGGG No data
Right 1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG No data
1022557755_1022557762 7 Left 1022557755 7:31316848-31316870 CCCACCTCTGGGGCTGCACCTTC No data
Right 1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG No data
1022557754_1022557762 8 Left 1022557754 7:31316847-31316869 CCCCACCTCTGGGGCTGCACCTT No data
Right 1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022557762 Original CRISPR AGTAGAGGGTTCAGGCAGCT TGG Intergenic