ID: 1022557800

View in Genome Browser
Species Human (GRCh38)
Location 7:31317195-31317217
Sequence GTGTGTGCACAGATTTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022557800_1022557803 -5 Left 1022557800 7:31317195-31317217 CCACCCTAAATCTGTGCACACAC No data
Right 1022557803 7:31317213-31317235 CACACTCTAGACCAAGCTCCAGG No data
1022557800_1022557804 2 Left 1022557800 7:31317195-31317217 CCACCCTAAATCTGTGCACACAC No data
Right 1022557804 7:31317220-31317242 TAGACCAAGCTCCAGGTGCCTGG No data
1022557800_1022557805 3 Left 1022557800 7:31317195-31317217 CCACCCTAAATCTGTGCACACAC No data
Right 1022557805 7:31317221-31317243 AGACCAAGCTCCAGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022557800 Original CRISPR GTGTGTGCACAGATTTAGGG TGG (reversed) Intergenic
No off target data available for this crispr