ID: 1022559749

View in Genome Browser
Species Human (GRCh38)
Location 7:31336260-31336282
Sequence TCGGCACCTTTGCCCCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022559745_1022559749 -6 Left 1022559745 7:31336243-31336265 CCCGCGCCAGCAGCTGCTCGGCA No data
Right 1022559749 7:31336260-31336282 TCGGCACCTTTGCCCCTCGGTGG No data
1022559743_1022559749 19 Left 1022559743 7:31336218-31336240 CCAGCTTAGAAGGGCGCGTTCAG No data
Right 1022559749 7:31336260-31336282 TCGGCACCTTTGCCCCTCGGTGG No data
1022559746_1022559749 -7 Left 1022559746 7:31336244-31336266 CCGCGCCAGCAGCTGCTCGGCAC No data
Right 1022559749 7:31336260-31336282 TCGGCACCTTTGCCCCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022559749 Original CRISPR TCGGCACCTTTGCCCCTCGG TGG Intergenic