ID: 1022560344

View in Genome Browser
Species Human (GRCh38)
Location 7:31341937-31341959
Sequence AAGAGAAAACAGGAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022560344_1022560358 18 Left 1022560344 7:31341937-31341959 CCACCTTCCTCCTGTTTTCTCTT No data
Right 1022560358 7:31341978-31342000 TATAAAGGACATTTGATTTCAGG No data
1022560344_1022560350 3 Left 1022560344 7:31341937-31341959 CCACCTTCCTCCTGTTTTCTCTT No data
Right 1022560350 7:31341963-31341985 CCGTGCCCCCACCCCTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022560344 Original CRISPR AAGAGAAAACAGGAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr