ID: 1022560634

View in Genome Browser
Species Human (GRCh38)
Location 7:31345676-31345698
Sequence TCTCCAGTGACACTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022560631_1022560634 -8 Left 1022560631 7:31345661-31345683 CCCTGAACTCACTCATCTCCAGT No data
Right 1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG No data
1022560630_1022560634 -7 Left 1022560630 7:31345660-31345682 CCCCTGAACTCACTCATCTCCAG No data
Right 1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG No data
1022560629_1022560634 7 Left 1022560629 7:31345646-31345668 CCATCTTCTGCTTTCCCCTGAAC No data
Right 1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG No data
1022560628_1022560634 23 Left 1022560628 7:31345630-31345652 CCTGGCTTCTGCGATTCCATCTT No data
Right 1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG No data
1022560632_1022560634 -9 Left 1022560632 7:31345662-31345684 CCTGAACTCACTCATCTCCAGTG No data
Right 1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022560634 Original CRISPR TCTCCAGTGACACTGGCTGC TGG Intergenic