ID: 1022561043

View in Genome Browser
Species Human (GRCh38)
Location 7:31349812-31349834
Sequence TACGATGCTTCCTATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022561043_1022561046 17 Left 1022561043 7:31349812-31349834 CCTACTACATAGGAAGCATCGTA No data
Right 1022561046 7:31349852-31349874 TTAAAATAAAAATTGAGGAAGGG No data
1022561043_1022561048 21 Left 1022561043 7:31349812-31349834 CCTACTACATAGGAAGCATCGTA No data
Right 1022561048 7:31349856-31349878 AATAAAAATTGAGGAAGGGTGGG No data
1022561043_1022561044 12 Left 1022561043 7:31349812-31349834 CCTACTACATAGGAAGCATCGTA No data
Right 1022561044 7:31349847-31349869 TTAATTTAAAATAAAAATTGAGG No data
1022561043_1022561047 20 Left 1022561043 7:31349812-31349834 CCTACTACATAGGAAGCATCGTA No data
Right 1022561047 7:31349855-31349877 AAATAAAAATTGAGGAAGGGTGG No data
1022561043_1022561045 16 Left 1022561043 7:31349812-31349834 CCTACTACATAGGAAGCATCGTA No data
Right 1022561045 7:31349851-31349873 TTTAAAATAAAAATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022561043 Original CRISPR TACGATGCTTCCTATGTAGT AGG (reversed) Intergenic
No off target data available for this crispr