ID: 1022561200

View in Genome Browser
Species Human (GRCh38)
Location 7:31351701-31351723
Sequence GAGGCAGCACATATATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022561193_1022561200 9 Left 1022561193 7:31351669-31351691 CCCTATTTGACCCTGCTCGTTCC No data
Right 1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG No data
1022561194_1022561200 8 Left 1022561194 7:31351670-31351692 CCTATTTGACCCTGCTCGTTCCT No data
Right 1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG No data
1022561192_1022561200 13 Left 1022561192 7:31351665-31351687 CCTGCCCTATTTGACCCTGCTCG No data
Right 1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG No data
1022561195_1022561200 -1 Left 1022561195 7:31351679-31351701 CCCTGCTCGTTCCTCAGCTGCTG No data
Right 1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG No data
1022561196_1022561200 -2 Left 1022561196 7:31351680-31351702 CCTGCTCGTTCCTCAGCTGCTGA No data
Right 1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022561200 Original CRISPR GAGGCAGCACATATATTTGG TGG Intergenic
No off target data available for this crispr