ID: 1022561961

View in Genome Browser
Species Human (GRCh38)
Location 7:31358718-31358740
Sequence CTGCTCCTCTAGGTCTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022561956_1022561961 18 Left 1022561956 7:31358677-31358699 CCCTCGGCTCTTCCTGGAGGCTG No data
Right 1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG No data
1022561954_1022561961 23 Left 1022561954 7:31358672-31358694 CCGTTCCCTCGGCTCTTCCTGGA No data
Right 1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG No data
1022561952_1022561961 24 Left 1022561952 7:31358671-31358693 CCCGTTCCCTCGGCTCTTCCTGG No data
Right 1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG No data
1022561958_1022561961 6 Left 1022561958 7:31358689-31358711 CCTGGAGGCTGCACTTGCTCTCC No data
Right 1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG No data
1022561957_1022561961 17 Left 1022561957 7:31358678-31358700 CCTCGGCTCTTCCTGGAGGCTGC No data
Right 1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022561961 Original CRISPR CTGCTCCTCTAGGTCTGCAA TGG Intergenic
No off target data available for this crispr