ID: 1022563404

View in Genome Browser
Species Human (GRCh38)
Location 7:31373180-31373202
Sequence ATGGAGCATCAGCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022563404_1022563410 -10 Left 1022563404 7:31373180-31373202 CCTGCCCCTTGCTGATGCTCCAT No data
Right 1022563410 7:31373193-31373215 GATGCTCCATCAGGTAGACAGGG No data
1022563404_1022563412 7 Left 1022563404 7:31373180-31373202 CCTGCCCCTTGCTGATGCTCCAT No data
Right 1022563412 7:31373210-31373232 ACAGGGATCTCCCTCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022563404 Original CRISPR ATGGAGCATCAGCAAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr