ID: 1022565562

View in Genome Browser
Species Human (GRCh38)
Location 7:31397159-31397181
Sequence AATTAAGTATGGAAAGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022565562_1022565565 17 Left 1022565562 7:31397159-31397181 CCTCCTACTTTCCATACTTAATT No data
Right 1022565565 7:31397199-31397221 ATAGTTCAATAAAAGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022565562 Original CRISPR AATTAAGTATGGAAAGTAGG AGG (reversed) Intergenic
No off target data available for this crispr