ID: 1022570997

View in Genome Browser
Species Human (GRCh38)
Location 7:31454240-31454262
Sequence GGGGTTCATCTTACCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022570997_1022571005 12 Left 1022570997 7:31454240-31454262 CCCAGGGAGGTAAGATGAACCCC No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570997_1022571004 11 Left 1022570997 7:31454240-31454262 CCCAGGGAGGTAAGATGAACCCC No data
Right 1022571004 7:31454274-31454296 ATGCCTAAACCAGCCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022570997 Original CRISPR GGGGTTCATCTTACCTCCCT GGG (reversed) Intergenic