ID: 1022570998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:31454241-31454263 |
| Sequence | TGGGGTTCATCTTACCTCCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022570998_1022571005 | 11 | Left | 1022570998 | 7:31454241-31454263 | CCAGGGAGGTAAGATGAACCCCA | No data | ||
| Right | 1022571005 | 7:31454275-31454297 | TGCCTAAACCAGCCTGATATGGG | No data | ||||
| 1022570998_1022571004 | 10 | Left | 1022570998 | 7:31454241-31454263 | CCAGGGAGGTAAGATGAACCCCA | No data | ||
| Right | 1022571004 | 7:31454274-31454296 | ATGCCTAAACCAGCCTGATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022570998 | Original CRISPR | TGGGGTTCATCTTACCTCCC TGG (reversed) | Intergenic | ||