ID: 1022570998

View in Genome Browser
Species Human (GRCh38)
Location 7:31454241-31454263
Sequence TGGGGTTCATCTTACCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022570998_1022571005 11 Left 1022570998 7:31454241-31454263 CCAGGGAGGTAAGATGAACCCCA No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570998_1022571004 10 Left 1022570998 7:31454241-31454263 CCAGGGAGGTAAGATGAACCCCA No data
Right 1022571004 7:31454274-31454296 ATGCCTAAACCAGCCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022570998 Original CRISPR TGGGGTTCATCTTACCTCCC TGG (reversed) Intergenic