ID: 1022570999

View in Genome Browser
Species Human (GRCh38)
Location 7:31454259-31454281
Sequence TTAGGCATGGCTGCTGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022570999_1022571005 -7 Left 1022570999 7:31454259-31454281 CCCCAGCCAGCAGCCATGCCTAA 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570999_1022571010 17 Left 1022570999 7:31454259-31454281 CCCCAGCCAGCAGCCATGCCTAA 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022570999_1022571004 -8 Left 1022570999 7:31454259-31454281 CCCCAGCCAGCAGCCATGCCTAA 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1022571004 7:31454274-31454296 ATGCCTAAACCAGCCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022570999 Original CRISPR TTAGGCATGGCTGCTGGCTG GGG (reversed) Intergenic