ID: 1022570999 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:31454259-31454281 |
Sequence | TTAGGCATGGCTGCTGGCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 236 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 22, 4: 211} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022570999_1022571004 | -8 | Left | 1022570999 | 7:31454259-31454281 | CCCCAGCCAGCAGCCATGCCTAA | 0: 1 1: 0 2: 2 3: 22 4: 211 |
||
Right | 1022571004 | 7:31454274-31454296 | ATGCCTAAACCAGCCTGATATGG | No data | ||||
1022570999_1022571005 | -7 | Left | 1022570999 | 7:31454259-31454281 | CCCCAGCCAGCAGCCATGCCTAA | 0: 1 1: 0 2: 2 3: 22 4: 211 |
||
Right | 1022571005 | 7:31454275-31454297 | TGCCTAAACCAGCCTGATATGGG | No data | ||||
1022570999_1022571010 | 17 | Left | 1022570999 | 7:31454259-31454281 | CCCCAGCCAGCAGCCATGCCTAA | 0: 1 1: 0 2: 2 3: 22 4: 211 |
||
Right | 1022571010 | 7:31454299-31454321 | CACCCACTGTGCTCTAGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022570999 | Original CRISPR | TTAGGCATGGCTGCTGGCTG GGG (reversed) | Intergenic | ||