ID: 1022571000

View in Genome Browser
Species Human (GRCh38)
Location 7:31454260-31454282
Sequence TTTAGGCATGGCTGCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571000_1022571010 16 Left 1022571000 7:31454260-31454282 CCCAGCCAGCAGCCATGCCTAAA No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571000_1022571004 -9 Left 1022571000 7:31454260-31454282 CCCAGCCAGCAGCCATGCCTAAA No data
Right 1022571004 7:31454274-31454296 ATGCCTAAACCAGCCTGATATGG No data
1022571000_1022571005 -8 Left 1022571000 7:31454260-31454282 CCCAGCCAGCAGCCATGCCTAAA No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571000 Original CRISPR TTTAGGCATGGCTGCTGGCT GGG (reversed) Intergenic