ID: 1022571001

View in Genome Browser
Species Human (GRCh38)
Location 7:31454261-31454283
Sequence GTTTAGGCATGGCTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571001_1022571010 15 Left 1022571001 7:31454261-31454283 CCAGCCAGCAGCCATGCCTAAAC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571001_1022571004 -10 Left 1022571001 7:31454261-31454283 CCAGCCAGCAGCCATGCCTAAAC No data
Right 1022571004 7:31454274-31454296 ATGCCTAAACCAGCCTGATATGG No data
1022571001_1022571005 -9 Left 1022571001 7:31454261-31454283 CCAGCCAGCAGCCATGCCTAAAC No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571001 Original CRISPR GTTTAGGCATGGCTGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr