ID: 1022571002

View in Genome Browser
Species Human (GRCh38)
Location 7:31454265-31454287
Sequence GCTGGTTTAGGCATGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571002_1022571010 11 Left 1022571002 7:31454265-31454287 CCAGCAGCCATGCCTAAACCAGC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571002 Original CRISPR GCTGGTTTAGGCATGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr