ID: 1022571005

View in Genome Browser
Species Human (GRCh38)
Location 7:31454275-31454297
Sequence TGCCTAAACCAGCCTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571000_1022571005 -8 Left 1022571000 7:31454260-31454282 CCCAGCCAGCAGCCATGCCTAAA No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022571001_1022571005 -9 Left 1022571001 7:31454261-31454283 CCAGCCAGCAGCCATGCCTAAAC No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570997_1022571005 12 Left 1022570997 7:31454240-31454262 CCCAGGGAGGTAAGATGAACCCC No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570999_1022571005 -7 Left 1022570999 7:31454259-31454281 CCCCAGCCAGCAGCCATGCCTAA 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data
1022570998_1022571005 11 Left 1022570998 7:31454241-31454263 CCAGGGAGGTAAGATGAACCCCA No data
Right 1022571005 7:31454275-31454297 TGCCTAAACCAGCCTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571005 Original CRISPR TGCCTAAACCAGCCTGATAT GGG Intergenic