ID: 1022571007

View in Genome Browser
Species Human (GRCh38)
Location 7:31454283-31454305
Sequence GTGGGTGGCCCATATCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571007_1022571010 -7 Left 1022571007 7:31454283-31454305 CCAGCCTGATATGGGCCACCCAC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571007 Original CRISPR GTGGGTGGCCCATATCAGGC TGG (reversed) Intergenic