ID: 1022571010

View in Genome Browser
Species Human (GRCh38)
Location 7:31454299-31454321
Sequence CACCCACTGTGCTCTAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022571000_1022571010 16 Left 1022571000 7:31454260-31454282 CCCAGCCAGCAGCCATGCCTAAA No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022570999_1022571010 17 Left 1022570999 7:31454259-31454281 CCCCAGCCAGCAGCCATGCCTAA No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571003_1022571010 4 Left 1022571003 7:31454272-31454294 CCATGCCTAAACCAGCCTGATAT No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571001_1022571010 15 Left 1022571001 7:31454261-31454283 CCAGCCAGCAGCCATGCCTAAAC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571002_1022571010 11 Left 1022571002 7:31454265-31454287 CCAGCAGCCATGCCTAAACCAGC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571007_1022571010 -7 Left 1022571007 7:31454283-31454305 CCAGCCTGATATGGGCCACCCAC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data
1022571006_1022571010 -1 Left 1022571006 7:31454277-31454299 CCTAAACCAGCCTGATATGGGCC No data
Right 1022571010 7:31454299-31454321 CACCCACTGTGCTCTAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022571010 Original CRISPR CACCCACTGTGCTCTAGACA TGG Intergenic
No off target data available for this crispr