ID: 1022575744

View in Genome Browser
Species Human (GRCh38)
Location 7:31495323-31495345
Sequence GTTTAAAAGGGGAAAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022575738_1022575744 5 Left 1022575738 7:31495295-31495317 CCCATGAACTTCTATAAATGTTA No data
Right 1022575744 7:31495323-31495345 GTTTAAAAGGGGAAAGCAGCTGG No data
1022575739_1022575744 4 Left 1022575739 7:31495296-31495318 CCATGAACTTCTATAAATGTTAT No data
Right 1022575744 7:31495323-31495345 GTTTAAAAGGGGAAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022575744 Original CRISPR GTTTAAAAGGGGAAAGCAGC TGG Intergenic
No off target data available for this crispr