ID: 1022576308

View in Genome Browser
Species Human (GRCh38)
Location 7:31500531-31500553
Sequence ATTGAAAAGTGGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022576308_1022576316 27 Left 1022576308 7:31500531-31500553 CCTTCCACATTCCACTTTTCAAT No data
Right 1022576316 7:31500581-31500603 GCTCAATTAGGACATATAAAGGG No data
1022576308_1022576314 15 Left 1022576308 7:31500531-31500553 CCTTCCACATTCCACTTTTCAAT No data
Right 1022576314 7:31500569-31500591 ATAAATCTCAGAGCTCAATTAGG No data
1022576308_1022576315 26 Left 1022576308 7:31500531-31500553 CCTTCCACATTCCACTTTTCAAT No data
Right 1022576315 7:31500580-31500602 AGCTCAATTAGGACATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022576308 Original CRISPR ATTGAAAAGTGGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr