ID: 1022577613

View in Genome Browser
Species Human (GRCh38)
Location 7:31513550-31513572
Sequence AATTTTGTGCATCTTGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022577608_1022577613 24 Left 1022577608 7:31513503-31513525 CCACACAGACTTCTTCACAATTC No data
Right 1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG No data
1022577609_1022577613 2 Left 1022577609 7:31513525-31513547 CCCTGAATGTACCATTCTGTTGG No data
Right 1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG No data
1022577612_1022577613 -9 Left 1022577612 7:31513536-31513558 CCATTCTGTTGGCTAATTTTGTG No data
Right 1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG No data
1022577611_1022577613 1 Left 1022577611 7:31513526-31513548 CCTGAATGTACCATTCTGTTGGC No data
Right 1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022577613 Original CRISPR AATTTTGTGCATCTTGTATA TGG Intergenic
No off target data available for this crispr