ID: 1022579770

View in Genome Browser
Species Human (GRCh38)
Location 7:31539729-31539751
Sequence CTAAGGTTATTTAAGGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022579764_1022579770 28 Left 1022579764 7:31539678-31539700 CCTGAGAGGGGCTTCTGGCTGAT 0: 29
1: 69
2: 89
3: 110
4: 223
Right 1022579770 7:31539729-31539751 CTAAGGTTATTTAAGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022579770 Original CRISPR CTAAGGTTATTTAAGGGTTC AGG Intronic
No off target data available for this crispr