ID: 1022581445

View in Genome Browser
Species Human (GRCh38)
Location 7:31559207-31559229
Sequence GATTCTATTGGAGTAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022581445 Original CRISPR GATTCTATTGGAGTAGTAGC AGG (reversed) Intronic
904295628 1:29517978-29518000 GTTGCTATTGGAGAAGTGGCAGG - Intergenic
908380935 1:63595988-63596010 AATTCTACTGGAGTAGTGGAGGG - Intronic
909606111 1:77509911-77509933 GAATCTCTTGGATTGGTAGCTGG - Intronic
912495393 1:110088427-110088449 GAGTCTGTTGGAGTTGTAGCTGG + Intergenic
919671448 1:200341986-200342008 GATTCTCTTGAACAAGTAGCTGG + Intergenic
923556414 1:235004189-235004211 GATTCTTTTGGAGCAGTGGTTGG + Intergenic
1063066020 10:2609596-2609618 GTTTCTATTGGTCTAGTAGGAGG - Intergenic
1074193485 10:111158600-111158622 GAATATATTGGAGAAGTATCTGG + Intergenic
1075188648 10:120286116-120286138 AATTCTCTCGGAGTTGTAGCAGG + Intergenic
1077704340 11:4469871-4469893 GATTCTTTTGCAGCAGTAGTTGG + Intergenic
1079531488 11:21459928-21459950 GATTTTCTTGGAGAAGAAGCAGG + Intronic
1080069662 11:28066262-28066284 GATTCTCTTGGATTGGTAGCAGG - Intronic
1081446258 11:43134099-43134121 GATTTTATTGGATTTGTACCTGG - Intergenic
1085790649 11:79494316-79494338 GCTTCTCTTGGAGTAGTTGTGGG - Intergenic
1087304813 11:96475907-96475929 GATTCTAATGCAGTAATAGCTGG + Intronic
1091088613 11:132747992-132748014 GAATCTATTGGAGTAAGATCAGG - Intronic
1103003006 12:117400442-117400464 GATTCTATTAAAATAGTAGTTGG - Intronic
1111618552 13:90693946-90693968 GAATATCTTGGAGTAGTAGTAGG + Intergenic
1111707898 13:91774518-91774540 GAGTATATTGGAGAAGCAGCCGG + Intronic
1120543614 14:85782174-85782196 GATTCTATTGGAGATGAAGCTGG - Intergenic
1125026444 15:35034764-35034786 GATTCTATTTGTGTAATGGCAGG - Intergenic
1132110254 15:99097555-99097577 GATTGGATTGGAGCAGCAGCAGG + Intergenic
1133604972 16:7378069-7378091 GATTCTAATGGAGAAGTAGGAGG + Intronic
1138489839 16:57370380-57370402 CATTTTATGGGAGTAGAAGCTGG + Intergenic
1140812490 16:78591789-78591811 TATTCTAGTGCAGTGGTAGCTGG + Intronic
1144148402 17:12420234-12420256 AATTCTCTTGGGGCAGTAGCTGG + Intergenic
1155893607 18:31295725-31295747 AATCCTACTGTAGTAGTAGCTGG - Intergenic
1157362363 18:47031588-47031610 GATTCTCCTGGAGAAGTAGCTGG - Intronic
1159210197 18:65309957-65309979 GATTTTATTAGAGTAGGAGAAGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
926360029 2:12078255-12078277 GATTCTATTGGCCCAGTGGCAGG + Intergenic
927059686 2:19405003-19405025 GCCTCTATTGCAGTCGTAGCTGG + Intergenic
931171944 2:59812996-59813018 GTTTCTGTTGGAGAAGTAGCAGG - Intergenic
933822268 2:86124202-86124224 AATTATATTGGAGAATTAGCTGG + Intronic
942075102 2:172350393-172350415 GAATCTCTTGGAGTAGTGGCTGG - Intergenic
946919217 2:224560577-224560599 TTTTCTGTTGGAGTAGTAGTGGG - Intronic
947588171 2:231369903-231369925 GTTTCTAATGCTGTAGTAGCTGG + Intronic
1169088488 20:2841625-2841647 GATTCTATTGGGGGAGAATCAGG - Intronic
1177748457 21:25250801-25250823 GATTCTGTTGGAGCAGGTGCAGG + Intergenic
952621727 3:35352322-35352344 GATCCTATTTGAGAAGTAGTGGG - Intergenic
960107852 3:113817346-113817368 GATTCTATTACAGTAGTTTCAGG + Intergenic
960409189 3:117301304-117301326 CTTCCTATGGGAGTAGTAGCAGG - Intergenic
962599758 3:136982834-136982856 TTTTCTTTTGGAGTAGTACCTGG + Intronic
965506414 3:169520242-169520264 GATTTTACTGGAGAAGTAACTGG - Intronic
971425702 4:26512904-26512926 GATTGTATTGGGGTGGGAGCAGG - Intergenic
975830534 4:78363707-78363729 GGTTCTCTTGGGGCAGTAGCTGG + Intronic
979580184 4:122349258-122349280 GATTCTAAAGGAGGAGTAGTTGG + Exonic
992668663 5:79036751-79036773 GAATCTATAGGAGTAGTGTCTGG + Intronic
994607897 5:101993830-101993852 GAGTCTATTAGAGAAGTAGATGG - Intergenic
1002057558 5:176607293-176607315 GGTTCTAGTGGGGTAGTTGCGGG - Intronic
1006598598 6:35211504-35211526 TATTCTACAGGAGTAGAAGCAGG - Intergenic
1008062907 6:47017227-47017249 GATGATATTGGAGTGGTACCAGG + Intronic
1008277708 6:49560361-49560383 GATTCTGTTGGAGTGGAAGAAGG + Intronic
1015663948 6:135606133-135606155 GAGACTATTGGAGTGGGAGCAGG + Intergenic
1022581445 7:31559207-31559229 GATTCTATTGGAGTAGTAGCAGG - Intronic
1041221462 8:55655847-55655869 CACTCTATTTGAGTAGCAGCTGG - Intergenic
1041924955 8:63227358-63227380 TATTCAATTGGAGTAGGATCAGG + Intergenic
1043422628 8:80114556-80114578 GATTTTATTTGATTAGTAGTGGG - Intronic
1045396317 8:101764080-101764102 TATTCTAGTCGAGTAGTAGGTGG + Intronic
1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG + Intronic
1061847048 9:133393718-133393740 GGTTCTATTGGAGGTGTAGATGG + Intronic
1185944843 X:4363586-4363608 GGTTCTCTTGGAGTGGTAGTGGG + Intergenic
1188116310 X:26248258-26248280 GACTTTAATGAAGTAGTAGCTGG + Intergenic
1195413485 X:104594929-104594951 GATTAAATTAGAGAAGTAGCAGG + Intronic
1198653312 X:138887569-138887591 CATTCTAGTGGGGAAGTAGCGGG - Intronic
1200613833 Y:5355530-5355552 TATTCTTTTCAAGTAGTAGCAGG - Intronic
1201260243 Y:12152214-12152236 GATTGTATTGGAGTATTGGCGGG + Intergenic