ID: 1022582006

View in Genome Browser
Species Human (GRCh38)
Location 7:31564826-31564848
Sequence TGCCCTGAAGACACCTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022582003_1022582006 -8 Left 1022582003 7:31564811-31564833 CCTTCAACAGATTGCTGCCCTGA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1022582006 7:31564826-31564848 TGCCCTGAAGACACCTGGGCCGG 0: 1
1: 0
2: 2
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022582006 Original CRISPR TGCCCTGAAGACACCTGGGC CGG Intronic
900359948 1:2283651-2283673 CTCCCTGAAGCCCCCTGGGCTGG - Intronic
900616206 1:3566771-3566793 ATCCCAGCAGACACCTGGGCTGG + Intronic
900707232 1:4088542-4088564 AGGGCTGAAGACCCCTGGGCTGG + Intergenic
901463784 1:9407468-9407490 TCCCATGAAGACACCTTGGATGG - Intergenic
901630522 1:10645942-10645964 GCCCCTGGAGACCCCTGGGCAGG - Intronic
901647760 1:10725822-10725844 GGGCCTGAAGACAGCAGGGCAGG + Intronic
902552310 1:17226412-17226434 TGCACCCAAGACACCTGGGTTGG - Intronic
904125222 1:28233525-28233547 TGTTCTGAAGACAGCTGAGCCGG - Intergenic
904584032 1:31569229-31569251 GGGCCAGAAGACACCTGGCCGGG - Intergenic
905885288 1:41488467-41488489 GGCCCTGGAGCCGCCTGGGCTGG + Intergenic
906293149 1:44632608-44632630 GGCCCTGAAGAACCCTGGGGGGG + Intronic
907112355 1:51937397-51937419 TGCCCAGGACACAGCTGGGCAGG - Exonic
910843011 1:91578864-91578886 TGCCCTGTAAACATCTTGGCTGG + Intergenic
912176624 1:107165964-107165986 TGCTCTGTAGAGCCCTGGGCTGG + Intronic
913126375 1:115794063-115794085 TGCCTGGAAGACACCAGGGGAGG + Intergenic
915795857 1:158732887-158732909 TGAGCTGAAAACACCAGGGCAGG + Intergenic
918071910 1:181139510-181139532 TGCCCTGCAGACACCTGCAAGGG - Intergenic
924017648 1:239744749-239744771 TGCCTGGAAGACATCTGGGCTGG + Intronic
1062958323 10:1554546-1554568 TGCCCTGAAGTCACCTCCCCCGG - Intronic
1069802939 10:71093554-71093576 TCCCCTTAACACACCTGGGATGG + Intergenic
1069878215 10:71576068-71576090 TGCCCAGAGGCCCCCTGGGCGGG - Intronic
1069891693 10:71656263-71656285 GGCCCTGTAGACAGGTGGGCGGG + Intronic
1070518349 10:77228664-77228686 GGCCAAGAAGACACTTGGGCAGG - Intronic
1070692322 10:78536440-78536462 TGCCCTAAAGACACATGATCTGG + Intergenic
1070707021 10:78647177-78647199 ACCCCTGAACACACCTGGGCAGG - Intergenic
1073036373 10:100566783-100566805 GGCGGTAAAGACACCTGGGCTGG + Intergenic
1074019866 10:109571281-109571303 TGCCTTGAAGACATCTAAGCAGG + Intergenic
1075625012 10:123956800-123956822 TGCTCTGTTGTCACCTGGGCTGG - Intergenic
1075969521 10:126640611-126640633 TGCCCTGGAGAGACCTGGGGTGG + Intronic
1076114032 10:127882898-127882920 GGCCCTGAAGGCAGCTGGGCAGG + Intronic
1076858565 10:133129064-133129086 TGCCCTGAAGGCACCCGTGCAGG - Exonic
1076864769 10:133161160-133161182 TGCCCAGACGCCACCTTGGCTGG + Intronic
1077155247 11:1088177-1088199 TGTCCTGCAAACACCAGGGCAGG - Intergenic
1077160194 11:1109195-1109217 CACCCTGGAGACACCTGGCCGGG - Intergenic
1077535344 11:3121478-3121500 GGCTCTGCAGACACCAGGGCTGG + Intronic
1077550558 11:3198219-3198241 TCCCCAGAGGACCCCTGGGCTGG - Intergenic
1078672037 11:13374308-13374330 TGACCTGAAGAGTCCTAGGCTGG - Intronic
1079232083 11:18657487-18657509 TGCTCTGAAGCCACCTGCTCTGG + Intergenic
1082246102 11:49924651-49924673 TGCCTTGAAGATACTTGGGTAGG - Intergenic
1083458169 11:62792688-62792710 TGTCCTGAAGGCACCTGGAGTGG + Exonic
1083783154 11:64928442-64928464 TGCCCAGCAGAGACCTGGGGAGG + Intronic
1084429380 11:69102741-69102763 GCCCCTGAGTACACCTGGGCTGG + Intergenic
1085476697 11:76793745-76793767 TGCCCAGGATGCACCTGGGCTGG + Intronic
1087314610 11:96589680-96589702 TGCCCTCCTGACACCTGGTCCGG + Intergenic
1092118845 12:6029564-6029586 GGCACTGAAGACAGATGGGCAGG - Intronic
1092673182 12:10886224-10886246 TGACCTGAAGTCACCGAGGCAGG - Intronic
1096602988 12:52743396-52743418 GGCCCTGAAGAGACCCAGGCTGG + Intergenic
1097814637 12:64059063-64059085 AGCTCAGAAGACACCTGGGGAGG + Intronic
1101086736 12:101243875-101243897 TGACCACAAGACACCTGGGGTGG + Intergenic
1101536530 12:105623036-105623058 TGCCCGGGAGACCCCTGGCCAGG + Intergenic
1101946713 12:109142918-109142940 TGCCATGAAGACACGAGGGCAGG - Intronic
1102017535 12:109657533-109657555 TCCCCTGAGGACCCCTGGTCTGG - Intergenic
1102021887 12:109688743-109688765 TGCCCCTAAGACAGGTGGGCTGG + Intergenic
1102031361 12:109741807-109741829 TGCCCTGTGGAAACCTGGGCTGG - Intronic
1102346298 12:112163323-112163345 TGGCCTGCAGACCCCAGGGCTGG - Intronic
1102646933 12:114409613-114409635 GGCCCTGCAGCCACCTGGACCGG + Intergenic
1103521098 12:121537444-121537466 TGCACAGAAGCCACCTGAGCTGG - Intronic
1103850186 12:123928068-123928090 TCCCCTGAGGACTCCTGAGCAGG - Exonic
1104053206 12:125210204-125210226 TGGTCTGAGGAGACCTGGGCAGG + Intronic
1104895760 12:132162928-132162950 TGCCCGGGAGCCAGCTGGGCTGG - Intergenic
1106948480 13:34855227-34855249 TGCCATGAAGACCCTTGAGCAGG - Intergenic
1107377665 13:39821925-39821947 TGCCCTGAAGACACCCTAGGAGG - Intergenic
1112302106 13:98239915-98239937 GGGCCCAAAGACACCTGGGCAGG + Intronic
1112572926 13:100610195-100610217 TGCCATCAAGATAGCTGGGCTGG + Intronic
1113124192 13:106958174-106958196 TCCCCTGAAGCAACCTGGGCAGG + Intergenic
1119539628 14:75429301-75429323 TGCCCTGAGCACACGTGGTCGGG - Intronic
1121783717 14:96639200-96639222 TGCCATGAACACACTTTGGCAGG + Intergenic
1121888737 14:97569445-97569467 TGCCCAGAAGACATATGGGAAGG - Intergenic
1122287135 14:100658715-100658737 GGCACGGAAGTCACCTGGGCTGG - Intergenic
1122351825 14:101100551-101100573 TGCACTGAAGAAACCCAGGCTGG + Intergenic
1122579858 14:102764719-102764741 TGAGCCCAAGACACCTGGGCCGG + Intergenic
1123707452 15:22960238-22960260 TGCTGTCAAGACACTTGGGCTGG + Intronic
1124613042 15:31222187-31222209 TGCCTGGCAGTCACCTGGGCGGG + Intergenic
1125995297 15:44153936-44153958 TGCCCTGTCGTCACCTAGGCTGG - Intronic
1126663637 15:51055894-51055916 TGCCCTGTGCACACCTGGGCTGG - Intergenic
1127258108 15:57308068-57308090 TGCGCTGAGGACACATGGGAAGG - Intergenic
1127258121 15:57308127-57308149 TGCGCTGAGGACACATGGGAAGG - Intergenic
1127258134 15:57308186-57308208 TGCGCTGAGGACACATGGGAAGG - Intergenic
1127962307 15:63898904-63898926 TGCTCTGAGAATACCTGGGCTGG + Intergenic
1128808752 15:70554839-70554861 TGCACTGAAGAAGCCTGAGCAGG + Intergenic
1128979526 15:72176162-72176184 TGGGCTGCACACACCTGGGCGGG + Intronic
1129109807 15:73330756-73330778 TGCCCTGAACAGAGCTGAGCTGG + Intronic
1131113330 15:89778606-89778628 TACCCTAAAGGCAGCTGGGCAGG + Exonic
1131466141 15:92655967-92655989 TGCCACGATGACACTTGGGCTGG + Intronic
1131901575 15:97093613-97093635 TCCCTGAAAGACACCTGGGCTGG - Intergenic
1132011903 15:98283526-98283548 TTGCCTGAAGTCACCTGGGTAGG - Intergenic
1132556746 16:575978-576000 AGCCCTGCAGAGACCAGGGCAGG - Intronic
1132722176 16:1321819-1321841 CACCTTGCAGACACCTGGGCTGG - Intronic
1132727511 16:1345386-1345408 TGGCCTGAGGACACTGGGGCTGG + Intronic
1132871836 16:2118833-2118855 TGCCCTGCAGAAACCTGAGTGGG - Exonic
1132873880 16:2127415-2127437 TGCGCTGAAGGCACCGAGGCTGG + Intronic
1132907566 16:2290760-2290782 TGCTCTGGGGACACCTGTGCAGG - Intronic
1133205147 16:4228775-4228797 AGGCCTGAAGACCCCGGGGCTGG + Intronic
1134552967 16:15146589-15146611 TGCGCTGAAGGCACCGAGGCTGG + Intergenic
1135541075 16:23330855-23330877 TGCCCTTAAGAGATCTCGGCCGG - Intronic
1135670656 16:24372798-24372820 TGCCCTGGAGATACTTGGTCAGG - Intergenic
1136103351 16:28011292-28011314 TGCCCTGCAGGCGGCTGGGCTGG - Intronic
1136778786 16:32884968-32884990 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1136891832 16:33976550-33976572 TGCCCCCCAGACTCCTGGGCTGG + Intergenic
1137541158 16:49362786-49362808 TGCCATGAACACCCCAGGGCTGG + Intergenic
1139597920 16:67968758-67968780 TGGCGGGAAGACCCCTGGGCGGG + Intronic
1140722980 16:77788078-77788100 TGCCCTGAAGAGTCCAGTGCAGG - Intergenic
1141180014 16:81746143-81746165 TGCCCTGAGCACCCATGGGCTGG - Intronic
1142441486 16:90101062-90101084 TGCCCAGCAGACATCTCGGCTGG + Intergenic
1203081201 16_KI270728v1_random:1147057-1147079 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1142762332 17:2049987-2050009 TGCCCTGGAGACGCGGGGGCGGG + Intergenic
1143309341 17:5975643-5975665 CACCCTGCAGATACCTGGGCAGG - Intronic
1144411324 17:15004919-15004941 TGCCCAGAAGACAAATGGCCAGG + Intergenic
1146173416 17:30649905-30649927 GGCCCTGCATCCACCTGGGCAGG - Intergenic
1146346873 17:32065935-32065957 GGCCCTGCATCCACCTGGGCAGG - Intergenic
1146912983 17:36659951-36659973 TGACCTGAAGAAACCTTGGCTGG + Intergenic
1147178255 17:38670020-38670042 GGGGCTGAAGACACCTGGGAGGG + Intergenic
1147387860 17:40092299-40092321 TGCCCTGGGAACTCCTGGGCGGG + Intronic
1147934938 17:44005928-44005950 CGCTCTGAGGACGCCTGGGCGGG - Intronic
1148217873 17:45843622-45843644 TGGCCTGAAGAAGCCTGGACAGG + Intergenic
1151974160 17:77475135-77475157 TGCTCTGAAGAAAGCCGGGCTGG + Intronic
1152468144 17:80476993-80477015 TGCACTGAACACCCTTGGGCCGG + Intronic
1152642098 17:81453615-81453637 CCCCCAGGAGACACCTGGGCAGG - Intronic
1152695738 17:81793701-81793723 TCCCCTGCAGATTCCTGGGCTGG + Intergenic
1157326765 18:46674753-46674775 TCCCCTCTAGAGACCTGGGCTGG - Intronic
1159831347 18:73281606-73281628 TGCCATGAACACACCTCAGCTGG - Intergenic
1160801880 19:974123-974145 TGCCTTGGAGACCCCTGGGGAGG + Exonic
1161178938 19:2866734-2866756 TGACCAGTAGACACCTGGGGAGG - Intergenic
1161404692 19:4084724-4084746 TGCACTGGGGACATCTGGGCTGG + Intergenic
1162209074 19:9077417-9077439 TGGCCGGAAGACACCTGCCCTGG - Intergenic
1162481325 19:10928581-10928603 TCACCTGAGGCCACCTGGGCCGG + Exonic
1163109132 19:15147812-15147834 TGGCTTGGAGCCACCTGGGCAGG + Intergenic
1163633301 19:18427665-18427687 TGCCCAGAGAACATCTGGGCAGG - Intronic
1164846393 19:31436690-31436712 TGCACAGAAGAGACCAGGGCAGG - Intergenic
1165073249 19:33267690-33267712 TCCCCGGCAGACAGCTGGGCTGG + Intergenic
1165104729 19:33462160-33462182 GGCCCTGAGGACATCTGGGGTGG + Intronic
1165721483 19:38082411-38082433 GGCCCGGAAGAAACCTGCGCGGG + Exonic
1166047126 19:40236164-40236186 TGCCCTCAGGGCATCTGGGCTGG + Intronic
1166265644 19:41682624-41682646 TGCCCTGACTCCACCTGGGGTGG - Intronic
1166271780 19:41718889-41718911 TGCCCTGATTTCACCTGGGGTGG + Intronic
1166414882 19:42588252-42588274 TGCCCTGACTCCACCTGGGGTGG - Intronic
1166437897 19:42785180-42785202 TGCCCTGACTCCACCTGGGCTGG - Intronic
1166456846 19:42948972-42948994 TGCCCTGACTCCACCCGGGCTGG - Intronic
1166466797 19:43039841-43039863 TGCCCTGACTCCACCCGGGCTGG - Intronic
1166472934 19:43095919-43095941 TGCCCTGACTCCACCCGGGCTGG - Intronic
1166825089 19:45603604-45603626 TGCCTAGAAGACTGCTGGGCAGG + Intergenic
1167724186 19:51199749-51199771 TGTCCTGAAAGCACCTGGCCAGG + Intergenic
1168102109 19:54146784-54146806 TGCCCTGAGGGCAGGTGGGCAGG + Intronic
925860991 2:8174800-8174822 CGCCCTGATGCCACCTGGGATGG - Intergenic
925921290 2:8639533-8639555 TCTCCTGAAGTCACCTGTGCAGG + Intergenic
925989780 2:9245320-9245342 GGCTCTGGAGACACCTGGGGTGG + Intronic
926127771 2:10282552-10282574 TGTCCTGCAGACCCCTGGGAAGG + Intergenic
926189236 2:10715425-10715447 TGACCTCAAGAGTCCTGGGCTGG - Intergenic
926591652 2:14746018-14746040 TGCCCTGAAAATACCTCAGCAGG - Intergenic
926602033 2:14855337-14855359 TGCCCTGTAGACACCACAGCTGG - Intergenic
927966725 2:27275117-27275139 AGTCCTGAAGACAACTGGGAAGG + Intronic
928802908 2:35115753-35115775 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
929453435 2:42050921-42050943 TGCCCTGAAGCCTCCTGGGCAGG - Intronic
930030526 2:47055786-47055808 TGCCCAGGAGACACCTGGGGTGG - Intronic
932340791 2:70961513-70961535 TTTCCTGAGGACACCTGGGAGGG + Intronic
932456480 2:71852768-71852790 TGACCTCAAAACACCGGGGCTGG - Intergenic
934517550 2:94998315-94998337 TCCCTTGAAGGCACCTGCGCAGG + Intergenic
934818265 2:97348997-97349019 TGACCAGCAGAAACCTGGGCAGG + Intergenic
935287774 2:101580459-101580481 CACCATGGAGACACCTGGGCAGG - Intergenic
937088081 2:119185188-119185210 AGCTCTGAGGTCACCTGGGCTGG - Intergenic
937239142 2:120449223-120449245 TGCCCTGAGCTCCCCTGGGCAGG - Intergenic
943846550 2:192656156-192656178 TGCCCAGAAAAGCCCTGGGCAGG + Intergenic
944934553 2:204554263-204554285 TTCAGGGAAGACACCTGGGCTGG - Intronic
945947940 2:216012597-216012619 AGCCCTGAACAAAACTGGGCTGG + Intronic
948051772 2:234984063-234984085 TTCCCTGCTGACACGTGGGCTGG + Intronic
948388034 2:237593774-237593796 GGCTGTGAAGTCACCTGGGCTGG - Intronic
949060924 2:241956845-241956867 TGACTTGAAGGCAGCTGGGCTGG + Intergenic
1168764469 20:372358-372380 TGGGCTGAAGACAGCTGGTCTGG - Intronic
1170704496 20:18733128-18733150 CCCCCTGAGGACACCTGGGATGG - Intronic
1172663438 20:36583064-36583086 TGGCCTCAAAACACCTGGCCTGG - Intronic
1172830864 20:37833312-37833334 AGCCCTGAAGAGAGCTGAGCTGG + Intronic
1173661146 20:44734623-44734645 TGCCCTGAAGCCAGCAGGGGTGG + Intergenic
1175203052 20:57291108-57291130 GGACCCGAAGAGACCTGGGCAGG - Intergenic
1176216749 20:63951680-63951702 TGCCCTGCTGAGCCCTGGGCGGG - Intronic
1176216763 20:63951722-63951744 TGCCCTGCTGAGCCCTGGGCGGG - Intronic
1176216777 20:63951764-63951786 TGCCCTGCTGAGCCCTGGGCGGG - Intronic
1176239806 20:64070661-64070683 TGCCCTGAAGACACCGGGCCCGG - Intronic
1176242617 20:64082116-64082138 TGGCCAGACGACACCAGGGCTGG + Intronic
1176263227 20:64194312-64194334 TGACCTGAGGACATCTGGGGTGG - Intronic
1178637121 21:34313889-34313911 AGCACTGAAGACACATGGGCGGG - Intergenic
1178919090 21:36726847-36726869 TGCCCTGTCTACATCTGGGCTGG + Intronic
1179720620 21:43314204-43314226 TGCCCTGAGGCCACCAGGCCAGG - Intergenic
1179990650 21:44946794-44946816 TGCACTGAAGAGCCCCGGGCTGG + Intronic
1181051265 22:20239301-20239323 GGCCCAGGAGACATCTGGGCGGG - Intergenic
1181274988 22:21682574-21682596 GGCCCTGTAGAGGCCTGGGCTGG - Intronic
1181873573 22:25922487-25922509 GGAGCTGAAGACACCTGGGGAGG + Intronic
1183225806 22:36549085-36549107 CGCCCTGAAAACCTCTGGGCAGG - Intergenic
1183500327 22:38175021-38175043 TTCCCTGAAGGACCCTGGGCAGG + Intronic
1183745259 22:39688166-39688188 GGCCCTGAAGCATCCTGGGCTGG - Exonic
1183753455 22:39736176-39736198 TGCCATGAAGATACCAGAGCCGG - Intergenic
1184175593 22:42787112-42787134 TGAACGGAAGACGCCTGGGCTGG - Intergenic
1184676035 22:46044100-46044122 TCCCGAGGAGACACCTGGGCTGG - Intergenic
1184753332 22:46501966-46501988 TGCCCTGTAGAAAACAGGGCTGG + Intronic
1184859642 22:47165787-47165809 GGCCCTGATGCCACCTGGGGAGG - Intronic
1185301333 22:50082556-50082578 TGCTCTGCAGACGCCTGTGCAGG - Intronic
950018145 3:9768564-9768586 GGCCCTAATGACACCTGGCCTGG + Intronic
950426159 3:12925804-12925826 GGCCCTACAGACACCTGGCCAGG - Intronic
950534594 3:13571669-13571691 TGCCCTGAAGGAACCAGGACAGG - Intronic
952818779 3:37468155-37468177 TGCCCAGCAAACACCTGGGGAGG + Intronic
953638458 3:44683804-44683826 TGCCCAGAAGAAACCTCAGCTGG - Intergenic
954109561 3:48426554-48426576 TGCCCTGAAGTGAACAGGGCCGG + Intronic
958072489 3:88632276-88632298 TGACCTGAGGACACCAGGGGGGG - Intergenic
960165405 3:114395770-114395792 TGGCTTGAAGACCCCTGGGATGG + Intronic
961604741 3:128085332-128085354 GGCCCTGAACACATCTGTGCTGG + Intronic
965602991 3:170473092-170473114 TTCCCTGGAGGCACCTGGGTGGG - Intronic
967283840 3:187849749-187849771 TGCCCTGATGCCATCAGGGCAGG + Intergenic
967899445 3:194434506-194434528 TGCTCTCAAGACACTTGGGTGGG + Intronic
968361744 3:198152038-198152060 TGCCCAGCAGACATCTCGGCTGG + Intergenic
968635396 4:1675844-1675866 TGCCCTGCAGACCCCTAGGAGGG + Intronic
969536417 4:7758694-7758716 GGCAGTGAAGACACCGGGGCTGG + Exonic
970457409 4:16238747-16238769 TGCAGTGAAGACACCAGGGGTGG - Intergenic
971347154 4:25821982-25822004 TCCCCTGGACTCACCTGGGCGGG + Exonic
981119006 4:141026905-141026927 AGCTCTGAAGATACCTGAGCAGG + Intronic
988421166 5:31007919-31007941 TGCCCTGGGGACACCTGGTTAGG + Intergenic
997232096 5:132252905-132252927 AAACCTGAAGACACCTGGGTTGG + Intronic
997646430 5:135485034-135485056 TGCCCAGAGGCCACCTGGGGGGG - Intergenic
998716393 5:144889500-144889522 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
999576794 5:152987748-152987770 TGCCCTGAAGGCACCTAGGAAGG + Intergenic
1000807371 5:165812559-165812581 GGCCCTGAAAAAACATGGGCAGG - Intergenic
1001399847 5:171439948-171439970 TGCCCAGAATAACCCTGGGCAGG + Intronic
1001762323 5:174218477-174218499 TTCCCTGAGGAGTCCTGGGCTGG - Intronic
1002259730 5:177984833-177984855 ACCACTGAAGACCCCTGGGCCGG - Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005210339 6:23453371-23453393 TGCACAGAGAACACCTGGGCAGG + Intergenic
1005594660 6:27368000-27368022 TGCCCTGAGCACACCTGGTCAGG - Intergenic
1005666068 6:28057641-28057663 TGCCCTGATTACACCTGGTGAGG + Intergenic
1007180521 6:39926161-39926183 TGGGCTGAGGGCACCTGGGCAGG + Intronic
1007596130 6:43052496-43052518 TCCCCTGCAGACTCCTGGGAGGG + Exonic
1011263136 6:85489149-85489171 TGCCCTGGAGAAGCCTGTGCAGG + Intronic
1011779910 6:90776429-90776451 TACACTGAAGACACCTTTGCTGG + Intergenic
1018602195 6:165556403-165556425 TGCCTTGAAGACAGCTGTGATGG + Intronic
1018647336 6:165960845-165960867 GGCCCAGAAGACAGATGGGCAGG + Intronic
1018685697 6:166302628-166302650 TGCCGTGAAAACACATGGCCAGG + Intergenic
1018820284 6:167368732-167368754 TGCCCTCAGGAGACCTGGGGAGG + Intronic
1019216523 6:170447379-170447401 TGCCCTCTCCACACCTGGGCCGG - Intergenic
1019253937 7:36684-36706 TGCCCAGCAGACATCTCGGCTGG - Intergenic
1019308494 7:347598-347620 TGCCCTGAACTCACCTTGACTGG + Intergenic
1019870036 7:3751749-3751771 TGCCCTGAGGTCACCTTGCCTGG + Intronic
1020225841 7:6279276-6279298 TGCAGTGGAGACACCTGAGCAGG - Intergenic
1022275128 7:28847569-28847591 TGCAGAGAAGACCCCTGGGCGGG - Intergenic
1022582006 7:31564826-31564848 TGCCCTGAAGACACCTGGGCCGG + Intronic
1023837608 7:44077548-44077570 AGCCCTGAAGGCATCTAGGCTGG - Intronic
1025605569 7:63037914-63037936 TGCACTGAGGACACCTAGGATGG + Intergenic
1028165527 7:87534172-87534194 TGCCCTGAATACATCTGCTCTGG + Intronic
1028541349 7:91945544-91945566 TGCCCTAAAGCCCACTGGGCAGG - Intronic
1032845598 7:135749069-135749091 TGCCTGGCAGACACCAGGGCTGG + Intergenic
1034911036 7:154999045-154999067 TGTCCTCAAGACAGATGGGCTGG + Intronic
1035170367 7:157014084-157014106 TGCCCCAAAGCCAGCTGGGCTGG - Intergenic
1035263349 7:157675294-157675316 AGCCCTGAAGCCCCTTGGGCTGG + Intronic
1035297540 7:157875833-157875855 TGCCCTGGGGACGCCTGGCCTGG - Intronic
1035775185 8:2182372-2182394 TGCTCAGAGGCCACCTGGGCAGG - Intergenic
1038271874 8:26081928-26081950 TTCCCTGAAGGCACCTGTGGAGG - Intergenic
1039246416 8:35613560-35613582 TGCAGTGAAGAAACCTGGCCAGG + Intronic
1040104887 8:43535946-43535968 GGTCCTGTAGACACCTGGGATGG + Intergenic
1040336002 8:46416304-46416326 AGCCCTGAAGACTCCTGGGATGG - Intergenic
1041576041 8:59396345-59396367 TGCCCAGAGGACAACTGAGCAGG + Intergenic
1041640463 8:60194391-60194413 TGCAGAGAAGTCACCTGGGCTGG + Intronic
1042533622 8:69838245-69838267 GGCCCTCAAGCCACCAGGGCTGG - Intergenic
1044834698 8:96284961-96284983 TGCCCTGAGGCCACCAGGGAAGG + Intronic
1048257425 8:132915570-132915592 TGCCCAGGACACACCTGGGCTGG + Intronic
1049718584 8:144105141-144105163 GGCCCTGCGGTCACCTGGGCGGG - Intronic
1049741898 8:144244922-144244944 GGCCCTGGATCCACCTGGGCTGG + Intronic
1051847704 9:21470952-21470974 TCCCCTGGTGACACCTTGGCAGG - Intergenic
1053294785 9:36905098-36905120 TGCACTGAAGGCACATGGGCAGG + Intronic
1054782106 9:69174643-69174665 TACTCTGAAGTCACTTGGGCTGG + Intronic
1056935695 9:90913651-90913673 TGCCCAGAAGTCACCTGGATGGG + Intergenic
1061305423 9:129729948-129729970 GGCACTGTAGACACCTGGCCTGG - Intergenic
1061376473 9:130228031-130228053 TGCCATGTAGACACCTGCACAGG + Intronic
1062457279 9:136645690-136645712 TGCCCTGATGACACCTGCTGTGG - Intergenic
1062658771 9:137617820-137617842 TGCCCTAAAGAAACCTGGGAAGG + Intronic
1062732966 9:138119786-138119808 ACCCGTGAAGACACCTGGGACGG - Intronic
1186276827 X:7948480-7948502 CGCACTGGAGACCCCTGGGCTGG - Intergenic
1189882066 X:45503892-45503914 TGCCCAGCAGCCACCTGGTCTGG - Intergenic
1190711459 X:53073547-53073569 TGCCCTGGAGACATCCAGGCAGG - Intronic
1191694605 X:63977246-63977268 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
1194710528 X:97231047-97231069 TTCCCTGAAGACTCCTGTGAGGG + Intronic
1195128593 X:101832584-101832606 TGTCCTGAAGGCACCTGGGGTGG + Intronic
1195177599 X:102326254-102326276 TGTCCTGAAGGCACCTGGGGTGG - Exonic
1195181265 X:102360839-102360861 TGTCCTGAAGGCACCTGGGGTGG + Exonic
1195203343 X:102571205-102571227 TGTCCTGAAGGCACCTGGGGTGG - Intergenic
1197717321 X:129718911-129718933 TGCCACGAAGAGCCCTGGGCTGG + Intergenic
1199082912 X:143595927-143595949 CCCCCGGAAAACACCTGGGCAGG + Intergenic