ID: 1022582463

View in Genome Browser
Species Human (GRCh38)
Location 7:31569541-31569563
Sequence ATGTACTGGCTCAATGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022582463 Original CRISPR ATGTACTGGCTCAATGGAGA GGG (reversed) Intronic
903265753 1:22157012-22157034 TTGTCCTGGCACCATGGAGAGGG - Intergenic
908980835 1:69955804-69955826 ATTTATTGGCTCAATGTACAAGG - Intronic
912700774 1:111876781-111876803 ATGTATAGGCTTAAGGGAGAAGG + Intronic
915419152 1:155765880-155765902 AGGGACTGGTTCAATGGACAGGG + Exonic
924404562 1:243729523-243729545 AATTACTGGCTCAAAGGATATGG - Intronic
1063111582 10:3042621-3042643 ATGTATTGGTGCAATGGAGGAGG + Intergenic
1065125833 10:22573387-22573409 ATGTACCGGCTTAATGTTGATGG - Exonic
1065263750 10:23954097-23954119 ATGTTCTTGCTCAGTGGATATGG - Intronic
1067229538 10:44396874-44396896 ATCTTCAGGCTCCATGGAGAAGG + Intergenic
1068498319 10:57813745-57813767 ATGCACTGTCTCTACGGAGAAGG - Intergenic
1068848351 10:61706780-61706802 ATGTAGTGATTCAATGGAGAGGG - Intronic
1070392818 10:75985866-75985888 ATGTGATGGTTCAATGAAGATGG + Intronic
1070853790 10:79589148-79589170 GTGTACTGGTGCAATGGTGAGGG - Intergenic
1071754681 10:88523837-88523859 TTGTCCTGGCTCAATGGTAAGGG - Intronic
1076354830 10:129844101-129844123 CTGTCCTGGCTGAATGGAGTTGG - Intronic
1078866762 11:15304988-15305010 ATGGCCTGGCTCAAGGGAGCAGG - Intergenic
1079367050 11:19818637-19818659 ATGGACTGGCTCAAGAGAGTTGG - Intronic
1080342806 11:31286919-31286941 ATGTACTAGCCAAGTGGAGAAGG - Intronic
1080958907 11:37134691-37134713 ATGCACAGGCTCAAAGGAAAAGG + Intergenic
1085962382 11:81477219-81477241 ATCTTCTGGCTGAATAGAGAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087686335 11:101269752-101269774 ATGTACAGGCTTAGTGGAGGAGG + Intergenic
1096378263 12:51132768-51132790 ATGGAGTGGCTCAGTGGAGAGGG + Intronic
1097157981 12:57026619-57026641 CTGAACTGGCTGAAGGGAGAGGG + Intronic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1106868488 13:33993609-33993631 ATGTACTGTCTATATGGTGATGG + Intergenic
1113585341 13:111460668-111460690 AGGTGCTGGCTCAATGGATTAGG + Intergenic
1115779178 14:36750396-36750418 AGGTTCTGCCTCCATGGAGAAGG - Intronic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1122124892 14:99573593-99573615 ACGTTCTGGCTCAAAGGACAGGG + Intronic
1122885063 14:104707218-104707240 ATGTCCAGGGTCAAGGGAGAAGG - Intronic
1124040209 15:26094939-26094961 ATGTACAGGCTCACTGGACATGG - Intergenic
1128885065 15:71279292-71279314 ATCTACAGGCTCACTGGACACGG - Intronic
1131396604 15:92091413-92091435 ATGTTCTGCCTGAATGGAGGAGG - Intronic
1134691709 16:16195038-16195060 ACCTAGTGGCTCAATGGAGAAGG + Intronic
1138729789 16:59182399-59182421 ATGCACTGGCAAAATGGAGCAGG + Intergenic
1139506583 16:67401064-67401086 ATCTGCTGGATCGATGGAGACGG + Exonic
1141799775 16:86298859-86298881 CTGTACTGGCTCCCTGGAGCCGG + Intergenic
1142607588 17:1090706-1090728 GTGTTCTGGCTGAATGGACAGGG - Intronic
1146629849 17:34462066-34462088 ATGGAGTGGCTCAATGGAGGGGG - Intergenic
1148774043 17:50084371-50084393 ATGTACTGGATCTAAGGAAATGG - Intronic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1153374423 18:4359256-4359278 ATGAACTGGTTCAGAGGAGAAGG - Intronic
1154992516 18:21610284-21610306 ATGTATTGGCTCCATAGGGAAGG + Intergenic
1156376711 18:36521335-36521357 AGATACTGGTGCAATGGAGATGG - Intronic
1158476331 18:57783132-57783154 ATGCACTGGCTGAAGGGAGGCGG + Intronic
1166624167 19:44334881-44334903 CTCTACTAGGTCAATGGAGAAGG + Intronic
1166806911 19:45492961-45492983 AAGTGCTGGCTCGAAGGAGAAGG + Intronic
925184483 2:1837633-1837655 AGGAACAGGCTCAATGGGGAGGG + Intronic
928318018 2:30260723-30260745 ACAACCTGGCTCAATGGAGATGG + Intronic
931563962 2:63594048-63594070 ATGTTTTGGCTCAATGTAAATGG + Intronic
931619322 2:64193931-64193953 ATCTGCTGGCTGAATGCAGATGG + Intergenic
933656822 2:84895339-84895361 ATGAACTGGCTCTGTGAAGAGGG - Intronic
935621162 2:105130733-105130755 ATGTAATGGATCAATGCAGATGG + Intergenic
943601783 2:189930295-189930317 ATCAACTGGCTCCATGGAGGAGG + Intronic
946912363 2:224476891-224476913 AGGTACTGGCTCAAGGGAAAGGG - Intronic
1169806210 20:9561941-9561963 ATATCCTGACTCAATAGAGAGGG - Intronic
1170725777 20:18924940-18924962 ATGTACAGGGTCAAAGGAAAAGG - Intergenic
1173678806 20:44861586-44861608 ATGTACTGGCTAGAGGGACAAGG + Intergenic
1177310699 21:19388560-19388582 ATTTACAGCCTCACTGGAGAGGG + Intergenic
1179221667 21:39413277-39413299 ATCTTCTGTCTCAGTGGAGATGG - Intronic
953199515 3:40766428-40766450 ATGTGCTGCCTCAGGGGAGATGG + Intergenic
953329040 3:42036489-42036511 GGGTACTGGCTCATTGGAGCAGG + Intronic
953608919 3:44431202-44431224 TTGTCCTGGCTCACTGGGGATGG - Intergenic
955325341 3:58005883-58005905 ATGAACTGACTCACTGGAAATGG - Intergenic
957672254 3:83320292-83320314 TCCTACTGGCTCAATGGAAAAGG + Intergenic
961161925 3:124734595-124734617 GTGTACTGGGTTTATGGAGAGGG + Intronic
966087333 3:176084477-176084499 ATGTACAGTCTAAATGGACATGG - Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971515686 4:27482856-27482878 AGGTACTGGCCCACTGGAAAGGG + Intergenic
973952148 4:56026769-56026791 ATGTGCTGATTCACTGGAGATGG + Intronic
976297531 4:83486940-83486962 ATGGCCTGCCTCAAGGGAGATGG + Intronic
978862268 4:113464747-113464769 CTGTACTGGCTGAAGAGAGAAGG + Intronic
981048563 4:140289314-140289336 ATATGCTGGCTCAGAGGAGATGG - Intronic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
984793270 4:183633593-183633615 ATGTCCTGGGTCAAAGGAGCCGG - Intergenic
986129408 5:4912872-4912894 AGGCACTGGGTCAAGGGAGAAGG + Intergenic
987053852 5:14172503-14172525 AAGAACTGGCTTAATGGAGTGGG + Intronic
988641285 5:33042880-33042902 GTGCACTGGTTCAAGGGAGAAGG + Intergenic
995445774 5:112242033-112242055 AGGTACTGCCTCAATGTTGATGG + Intronic
996820356 5:127619767-127619789 AAGGACTGGCTCATGGGAGAGGG - Intergenic
999713701 5:154341914-154341936 ATGTACTGGCTCATGGGATGGGG - Intronic
1000535249 5:162470879-162470901 ATGTTCTGGCTCAAGCAAGAAGG + Intergenic
1009555733 6:65163516-65163538 GTGTACTAGATCAATGGTGAGGG + Intronic
1009679723 6:66875761-66875783 TTGTACTGGCTCAAGGGATGGGG + Intergenic
1010314713 6:74434354-74434376 ATGTGATGGATGAATGGAGAAGG + Intergenic
1016898237 6:149074936-149074958 ATGGAATGTCTCAATGGAGCTGG - Exonic
1017154948 6:151314690-151314712 ATGTTCTGGCCCATTTGAGAAGG + Intronic
1020718053 7:11703139-11703161 ACGTGCTGGCTCACTCGAGAAGG - Intronic
1020969776 7:14921313-14921335 GTGTGCTGGCAAAATGGAGAAGG + Intronic
1022046725 7:26627726-26627748 CTGCACTGGCCCAAGGGAGAAGG + Intergenic
1022582463 7:31569541-31569563 ATGTACTGGCTCAATGGAGAGGG - Intronic
1023233136 7:38054561-38054583 ATGTTATACCTCAATGGAGATGG + Intergenic
1026306507 7:69147133-69147155 ATGTACTGCCTCAAAGCACAAGG - Intergenic
1029922014 7:104275186-104275208 ATGTAATGAATCAAAGGAGATGG - Intergenic
1031414576 7:121480171-121480193 ATGTCCTGGCTCGGTGCAGAAGG - Intergenic
1036180249 8:6578189-6578211 CTGTAGTGGCTCATGGGAGAGGG + Intronic
1041754158 8:61295061-61295083 ATTTTCTGGCTCACTGGAAAAGG + Intronic
1041788568 8:61664526-61664548 ATGTACTGGATGATGGGAGAAGG + Intronic
1041789023 8:61670706-61670728 ATGTACAGGCTCAAGGGAAAGGG + Intronic
1043231789 8:77811864-77811886 ATGTCCTTGCTCAAATGAGAAGG + Intergenic
1044904929 8:96990623-96990645 TTGTACTGTCTCCAGGGAGAAGG - Intronic
1044964382 8:97560986-97561008 ATGTCCTGGCTCTAAGGAGATGG + Intergenic
1050256925 9:3803394-3803416 GTGTACTACCACAATGGAGATGG - Intergenic
1050581289 9:7060371-7060393 AGCTACTGGGTCAAGGGAGAGGG - Intronic
1051176901 9:14370068-14370090 ATGTACTGGGTGTTTGGAGATGG - Intronic
1055033804 9:71796721-71796743 AGGTACTGGTTCTGTGGAGAAGG - Intronic
1055044726 9:71911874-71911896 AAGGAATGGCTCACTGGAGAGGG + Intronic
1057163531 9:92908297-92908319 ATGTACAGGATCACTGGACACGG - Intergenic
1058015783 9:100030694-100030716 ATGTACAGGATCACTGGACATGG + Intronic
1060861113 9:126955813-126955835 ATGCATTGGCTCACTGGAAAGGG - Intronic
1189788393 X:44580608-44580630 AGGTACTTGCTCAATGTTGATGG - Intergenic
1191977494 X:66889705-66889727 ATGTACTGGCTCAAGGAAACTGG + Intergenic
1198228529 X:134668858-134668880 ATGTACTTGCTCACTGGGGGAGG - Intronic
1199659620 X:150035902-150035924 AAGTACTGCCTCACTGAAGAGGG - Intergenic