ID: 1022582889

View in Genome Browser
Species Human (GRCh38)
Location 7:31574477-31574499
Sequence AACCCAACACCATTTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022582889_1022582891 30 Left 1022582889 7:31574477-31574499 CCAGAAAAAAATGGTGTTGGGTT 0: 1
1: 0
2: 0
3: 21
4: 192
Right 1022582891 7:31574530-31574552 TTTACCACAGCATTCCTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022582889 Original CRISPR AACCCAACACCATTTTTTTC TGG (reversed) Intronic
901450699 1:9335201-9335223 AACCCCACAACATTCTTTTGAGG - Intronic
901779574 1:11584633-11584655 AACCCAACCACCTCTTTTTCAGG - Intergenic
905469199 1:38179116-38179138 AACCCTACATCATTCTTTTGGGG + Intergenic
906233890 1:44191410-44191432 ATCCCAACACCATTTGTGTTAGG + Intergenic
907039449 1:51245448-51245470 CACCCAACAGCCTTTTTTTTTGG + Intronic
907102472 1:51849439-51849461 AACCCAACAAGATTTTTTTGTGG + Intronic
907560607 1:55384147-55384169 AAGCAAACACCATTCTCTTCAGG - Intergenic
907990644 1:59579065-59579087 AACCCTTGACCATTTGTTTCGGG + Intronic
908934775 1:69362052-69362074 AAACCAAGACCATTTTGTTTTGG + Intergenic
908988993 1:70061662-70061684 GACCAAAAGCCATTTTTTTCAGG + Intronic
910406566 1:86897310-86897332 AATCCAACAGCATTATTTTTTGG + Intronic
911222083 1:95259124-95259146 GACCCCACATCATTATTTTCTGG + Intergenic
912023303 1:105135625-105135647 AACATAACATCTTTTTTTTCTGG + Intergenic
913718497 1:121565187-121565209 AACCCCCCACCTTTTTTTTTTGG + Intergenic
919132685 1:193471126-193471148 AACCAAGCCCCATTTATTTCTGG + Intergenic
919276876 1:195429729-195429751 TACCCAACATTATTTTTCTCTGG + Intergenic
919771983 1:201167478-201167500 AACCCAAGAACAGCTTTTTCAGG - Intronic
920974081 1:210769325-210769347 AACCAAAGAGCATTTTATTCTGG - Intronic
921117163 1:212103693-212103715 AACCCAACATCACTTTCTACAGG + Exonic
921592233 1:217018031-217018053 AAACCAACAACAACTTTTTCTGG + Intronic
922195284 1:223354263-223354285 AAACCAACAACACTTTATTCTGG - Intronic
923607886 1:235461268-235461290 AATCCAGCACCATTTTCTACAGG - Intronic
1064250285 10:13701357-13701379 AAGCCAACACCAGTTCTATCTGG - Exonic
1065397865 10:25260384-25260406 AAGCAAACACAATTTTTCTCTGG - Intronic
1065928467 10:30457622-30457644 AACAAAACACCACCTTTTTCTGG - Intronic
1066620826 10:37347824-37347846 AACCCAGCACCATTTTTATGTGG + Intronic
1076142242 10:128088688-128088710 AACGCAACACCAGTTCTTTGGGG + Intergenic
1078448088 11:11420054-11420076 AAACCAATTCAATTTTTTTCAGG - Intronic
1079578988 11:22038713-22038735 ACACCAACACTATTTTTTTGTGG - Intergenic
1080158829 11:29146037-29146059 AAGCCAACAAAATTTTTTTTAGG + Intergenic
1081117453 11:39221494-39221516 AACCCAATAACATTTCTTTATGG + Intergenic
1081482611 11:43503760-43503782 AAGACACCACCATTTTTTCCGGG - Intergenic
1082840897 11:57689129-57689151 AACACAACAGCATGATTTTCTGG - Intronic
1084645665 11:70456109-70456131 AACCCATGCCCATTTTTTGCTGG - Intergenic
1085874569 11:80390767-80390789 CATCCAATACAATTTTTTTCTGG + Intergenic
1086279388 11:85168903-85168925 AAACTAACAGAATTTTTTTCAGG + Intronic
1087200108 11:95336411-95336433 AAATGAACCCCATTTTTTTCAGG + Intergenic
1088096483 11:106106543-106106565 AACCAACCACCACTTTTTGCAGG - Intergenic
1089460141 11:118648182-118648204 AAGCCAACAGCAATCTTTTCTGG - Intronic
1091252015 11:134152061-134152083 AAACCAACTGCATTTCTTTCTGG + Intronic
1092977649 12:13760886-13760908 ACCACACCATCATTTTTTTCTGG + Intronic
1093565223 12:20594559-20594581 AACCCCACAGCATTTTGCTCAGG - Intronic
1093774987 12:23063313-23063335 GACCCAACCTCATTTTTGTCTGG - Intergenic
1095123341 12:38444233-38444255 AACAGACCTCCATTTTTTTCTGG - Intergenic
1098176861 12:67801643-67801665 AAGCCAAAAACAATTTTTTCTGG - Intergenic
1098204101 12:68088472-68088494 AATCCATCAGCAATTTTTTCAGG + Intergenic
1098345611 12:69499812-69499834 AATTCAACACCATTTTCTTCTGG - Intronic
1099069533 12:78028042-78028064 ATTCCAACACCATTCTCTTCTGG - Intronic
1099293159 12:80797554-80797576 AACTCAACACCTTCTTTCTCTGG - Exonic
1099822172 12:87726307-87726329 AACTCTAAACCATCTTTTTCTGG - Intergenic
1100387418 12:94116630-94116652 TACCCAACACCATTTATTTAAGG + Intergenic
1102183144 12:110927960-110927982 AACCCAACAAACTTTTTTTGGGG + Intergenic
1104799391 12:131543573-131543595 ATCCCCACAGCATTTTTTTCTGG + Intergenic
1105050674 12:133047718-133047740 AAACAAACATCATTTTCTTCTGG + Intronic
1106184955 13:27401269-27401291 AAGCCAACACCTTGTTTCTCAGG + Intergenic
1108959578 13:56207825-56207847 AACTCATAAGCATTTTTTTCCGG - Intergenic
1111047944 13:82840237-82840259 AACCAATCAATATTTTTTTCAGG - Intergenic
1114522034 14:23345851-23345873 AAACCAGCAACATTTTTGTCAGG - Intergenic
1115937089 14:38563831-38563853 AACCCCACGCCATTCTTTTCTGG - Intergenic
1116095529 14:40362200-40362222 AATCCAAGACTATTTTTTTAAGG + Intergenic
1116368415 14:44099642-44099664 AACACAGCACTATTTTTTTCTGG - Intergenic
1123633828 15:22282168-22282190 AACCAAACTGCATTTTCTTCAGG - Intergenic
1124202318 15:27689180-27689202 AACCCAACACAACTTTTGTTTGG + Intergenic
1125926873 15:43569996-43570018 ATCCCCCAACCATTTTTTTCTGG - Intronic
1125940017 15:43669561-43669583 ATCCCCCAACCATTTTTTTCTGG - Intergenic
1127108337 15:55641856-55641878 ACCCTAAAACAATTTTTTTCAGG + Intronic
1127398694 15:58564343-58564365 AACACAGCAGCATTTCTTTCGGG - Intronic
1127486607 15:59423935-59423957 GACCCCACATCATTTCTTTCTGG + Intronic
1130090522 15:80817016-80817038 CAGCCAACTCCATTCTTTTCTGG - Intronic
1130532937 15:84761293-84761315 TCCCAAACACCATTTTTATCAGG - Intronic
1131051834 15:89353567-89353589 TACCCCACACCTTTTTTTTTTGG + Intergenic
1131339514 15:91583992-91584014 AACAAAACCCCATTTTATTCTGG - Intergenic
1132631758 16:921130-921152 AAACAAAGACCATTTTCTTCTGG + Intronic
1133203790 16:4220654-4220676 AACCCAACAGCAGCTTTCTCTGG + Intronic
1133798762 16:9067848-9067870 AACCGAACCCTGTTTTTTTCAGG + Intergenic
1134807776 16:17140252-17140274 AAACCAACACCCTTTTCTTCAGG + Intronic
1135329171 16:21546840-21546862 AGCCCAACACCCTTATTTTATGG + Intergenic
1136339510 16:29632783-29632805 AGCCCAACACCCTTATTTTATGG + Intergenic
1137745822 16:50819319-50819341 AATCCACCCCCACTTTTTTCTGG + Intergenic
1137748184 16:50838797-50838819 AAACCAACACACTTGTTTTCTGG + Intergenic
1139175641 16:64684016-64684038 AAATCACCACCATTTTTTTTTGG + Intergenic
1140852772 16:78950426-78950448 AACCCAACATCTTTTTCATCAGG - Intronic
1141073785 16:80983473-80983495 AACCTAACACCCTTTTCTTAAGG + Intronic
1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG + Intergenic
1145083710 17:19917460-19917482 AACAAAACACAATTTTTTTAAGG - Intronic
1149236875 17:54601680-54601702 AACCCAAAACACTTTTTTTATGG - Intergenic
1149654627 17:58303595-58303617 AACCCCAAACCATTATTCTCTGG - Intronic
1151691242 17:75686890-75686912 AAACCAACATCATTTTATTCTGG + Intronic
1155730872 18:29156635-29156657 TACCCACCTCCACTTTTTTCAGG + Intergenic
1155850257 18:30765848-30765870 GATCCAGCACCATGTTTTTCAGG + Intergenic
1156126334 18:33910182-33910204 ATTACAACACTATTTTTTTCTGG + Intronic
1157949589 18:52019739-52019761 AACTCAACAACATTTTTCTCTGG - Intergenic
1158748946 18:60236272-60236294 CAGCCAACACCATTTTTTCTTGG + Intergenic
1159863924 18:73682471-73682493 TACCTAAAACCATTTTGTTCTGG + Intergenic
1160422540 18:78757013-78757035 AACGGAATACAATTTTTTTCAGG + Intergenic
1162265250 19:9568125-9568147 ACCTCAACAACATTTTTTTTTGG - Exonic
1163220529 19:15915071-15915093 AAATCGGCACCATTTTTTTCTGG - Intronic
1165001033 19:32762591-32762613 ATCCCAACACCAGTTTTACCTGG - Intronic
1166032471 19:40142832-40142854 AAACCAAAACCATTGTTTTGTGG - Intergenic
1166154921 19:40903764-40903786 TCCCCAACAGCATTTTTCTCTGG - Intergenic
1168131379 19:54321975-54321997 AACACTATACCATTTTTCTCTGG - Intergenic
925696949 2:6590560-6590582 CACCCCACCCCATTTTTTTAGGG - Intergenic
927428276 2:23005214-23005236 CACCCAGAACCATTTTTTTCTGG + Intergenic
929475871 2:42247724-42247746 AACCAAACAAAATTGTTTTCTGG - Intronic
930644969 2:53896412-53896434 AAGAAAAAACCATTTTTTTCTGG - Intronic
930839608 2:55830965-55830987 ATCCCAACACCATTTATTGAAGG - Intergenic
931031958 2:58186596-58186618 AATGCAAGAGCATTTTTTTCCGG + Intronic
932746994 2:74342139-74342161 AACCCAAGACCAGTTGATTCTGG + Intronic
933029166 2:77304418-77304440 AACCCAATACCTCTTCTTTCTGG - Intronic
933858199 2:86439329-86439351 AATCCAGCAGCATTTTTTTTAGG - Intergenic
935883794 2:107593801-107593823 AACACAACATCTTTTTTTCCAGG + Intergenic
937522444 2:122728580-122728602 AACCCAACACTCTTTTTATAAGG + Intergenic
937738194 2:125316514-125316536 AATCCAACACTATTTTTTAAAGG + Intergenic
939989795 2:148866622-148866644 AATGCAACATCATTTCTTTCAGG + Intergenic
940405170 2:153293128-153293150 AAACCAACCCCATTTTTATAGGG + Intergenic
941443800 2:165574308-165574330 AACCCCAGTACATTTTTTTCAGG - Intronic
942042403 2:172079491-172079513 AACCCAACACCACATTATGCTGG - Intronic
945596850 2:211806451-211806473 TACCCTTCACCATTTTTTTAAGG + Intronic
947255867 2:228163201-228163223 AACACAACCCAATGTTTTTCTGG + Intronic
1168919949 20:1523609-1523631 AACCCAGCAAGGTTTTTTTCAGG + Intergenic
1169805131 20:9551495-9551517 AACCCTCCACCATTCTTTTGTGG - Intronic
1181660028 22:24339654-24339676 TCCCCAACACCATTATTTTAGGG - Intronic
1184912975 22:47548363-47548385 CACCCAACACCATTTATTAAAGG - Intergenic
949280077 3:2335565-2335587 AAACCCACAGAATTTTTTTCTGG - Intronic
949411377 3:3768617-3768639 AACCCATCACTATTTTGTTAGGG - Intronic
949635272 3:5975345-5975367 AACCCCACAACATCTTTTTCTGG - Intergenic
950383918 3:12641470-12641492 AACCAAAAAACATTTTTTTTTGG - Intronic
951390481 3:22097312-22097334 AACCCAACACCATATATTTTAGG - Intronic
951485484 3:23204051-23204073 AACCGAAGCCCATTTTTCTCTGG + Intronic
952229412 3:31414385-31414407 TACCCATGACCTTTTTTTTCAGG + Intergenic
954720668 3:52559597-52559619 AACTCAACACCACTGATTTCAGG + Intronic
955597611 3:60608593-60608615 GACCCAACTCCTTTTTTTCCTGG - Intronic
956173352 3:66450532-66450554 AACCCAAGACCATGTTTCACAGG + Intronic
957248968 3:77748699-77748721 AAACCTACATCCTTTTTTTCTGG - Intergenic
957894104 3:86397949-86397971 AACCAACCACAATTTTTTACTGG + Intergenic
961403135 3:126661080-126661102 AACCCAAAACCTGTATTTTCAGG - Intergenic
961516095 3:127437714-127437736 AACCCAACAGAATTTTTCTGAGG + Intergenic
963340953 3:144032870-144032892 AAGCCAAAACAATGTTTTTCTGG + Intronic
963381431 3:144535360-144535382 TTCCCAAGACCACTTTTTTCAGG + Intergenic
964982027 3:162696523-162696545 AACCCAAGTCCATTCTGTTCAGG + Intergenic
966997555 3:185298253-185298275 TGTCCCACACCATTTTTTTCAGG + Intronic
967210545 3:187164425-187164447 AACTTAAAAACATTTTTTTCAGG - Intronic
967580808 3:191151409-191151431 AATCCAACAGGTTTTTTTTCTGG + Intergenic
967597572 3:191345227-191345249 AATCCAAAACCTTTTTTTGCTGG - Intronic
967756162 3:193171561-193171583 GACCCAACACCATTTGTTAGAGG - Intergenic
972396277 4:38662498-38662520 AATCCAACTCTTTTTTTTTCTGG + Intergenic
976336447 4:83893582-83893604 AATCCAATACGATGTTTTTCAGG - Intergenic
976744888 4:88392596-88392618 CACCCAACTCCATTTTATTAGGG - Intronic
976756526 4:88504169-88504191 AGCCCCTCACCATTTTGTTCAGG + Intronic
978706571 4:111719969-111719991 AAAACAAGTCCATTTTTTTCAGG + Intergenic
978749453 4:112231263-112231285 AACGCACCAAGATTTTTTTCCGG - Intergenic
979804033 4:124948820-124948842 AACTCAAAACCATCTTTTTAAGG - Intergenic
980478197 4:133348093-133348115 AACCTAACACCATGTATTTTGGG + Intergenic
981058293 4:140389977-140389999 AACCAAAAACCAGTTTTCTCTGG - Intronic
983113190 4:163779628-163779650 AGCCCATCACTTTTTTTTTCTGG - Intronic
983758834 4:171378939-171378961 AACCCAACAACATTCTTTCCAGG - Intergenic
983793926 4:171836167-171836189 AGCCCAACCCCATTTTCTTGAGG - Intronic
984597794 4:181690412-181690434 AAGCAAAGACCATTTGTTTCTGG + Intergenic
984928553 4:184826703-184826725 AAGCCAACACGATGGTTTTCGGG + Exonic
985355394 4:189113878-189113900 AACCCAACAATTTTCTTTTCAGG - Intergenic
985798737 5:1986460-1986482 AAACCAACATTTTTTTTTTCAGG - Intergenic
986930921 5:12820041-12820063 AATCCCACAGCATTTTTTTGTGG + Intergenic
987552189 5:19397473-19397495 TACCAATCACCATTATTTTCAGG + Intergenic
987900786 5:24009002-24009024 ATACCAACACCATTTTTTTATGG - Intronic
988133792 5:27141391-27141413 AACTCAGAGCCATTTTTTTCTGG - Intergenic
988204452 5:28115773-28115795 AAACAAAAACCATTTTTTTGAGG - Intergenic
988902914 5:35753311-35753333 AACCAAACACATTTTTTTTTAGG + Intronic
992126067 5:73642844-73642866 AAACCAACAGATTTTTTTTCAGG - Intronic
992621914 5:78602470-78602492 AACCTTATACCATTCTTTTCTGG - Intronic
994560401 5:101363181-101363203 AGGCCAAGACCATTTTATTCTGG + Intergenic
997627942 5:135343782-135343804 AACCCAAAACAATTATTTTGAGG - Exonic
997846727 5:137293183-137293205 CACACAGCACCATTTATTTCAGG + Intronic
998876305 5:146603511-146603533 AACCTACCACCATTTATTTGTGG + Intronic
1000165845 5:158648015-158648037 AATCAAACACCATTTTATTTTGG + Intergenic
1004300710 6:14454741-14454763 AACCCCTAACCAGTTTTTTCCGG + Intergenic
1004963635 6:20821736-20821758 AAGCCAACAGGATTTTCTTCTGG + Intronic
1005258684 6:24033374-24033396 AACCCAATTCCATTTTCTCCTGG + Intergenic
1005283550 6:24300899-24300921 AAGTCAAAAGCATTTTTTTCAGG - Intronic
1005288159 6:24351174-24351196 AACCCAAAAACCTTTCTTTCTGG + Intronic
1005645153 6:27831003-27831025 TACCCAACACAACTTGTTTCAGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010143287 6:72636413-72636435 AAACCACCTGCATTTTTTTCTGG + Intronic
1010801066 6:80176261-80176283 AATCACACACCATTTATTTCAGG - Intronic
1012628116 6:101429655-101429677 AAACCCTCTCCATTTTTTTCAGG - Intronic
1012997088 6:105984892-105984914 AGAGCAACACCATTTTTTTCAGG - Intergenic
1013114616 6:107092858-107092880 AACACAATACCATTTATATCAGG + Intronic
1014081455 6:117291398-117291420 AAATATACACCATTTTTTTCTGG - Intronic
1016148668 6:140708132-140708154 AACCAAACAAAATTTGTTTCAGG - Intergenic
1019986044 7:4656642-4656664 GAACAAACACCCTTTTTTTCAGG - Intergenic
1020465859 7:8478187-8478209 AAACCTACACCATGTTTTTCTGG - Intronic
1022582889 7:31574477-31574499 AACCCAACACCATTTTTTTCTGG - Intronic
1024743519 7:52381293-52381315 AATTCACCACCATTTTTTTGTGG - Intergenic
1026326496 7:69315098-69315120 AGCCCACCACCATTTTTTCGGGG + Intergenic
1027414917 7:77964405-77964427 AACCCAATTCCATGTTTTTCAGG - Intergenic
1031350606 7:120726130-120726152 AGCCCAAGAACATTTTTTTTTGG - Intronic
1032707764 7:134436128-134436150 AACTAAACAACATTTTTTTAAGG - Intergenic
1037330371 8:17738172-17738194 AACCAAAAACCATCTCTTTCAGG + Intronic
1039698775 8:39941371-39941393 AACCAAATACCAGTTGTTTCAGG + Intronic
1043692773 8:83176714-83176736 AACAAAACCCAATTTTTTTCTGG + Intergenic
1044565590 8:93658581-93658603 ACCCCACCACCATTTATTTAGGG + Intergenic
1045376063 8:101575283-101575305 AACCACCCACCATTTTTTCCAGG - Intronic
1047905229 8:129465969-129465991 AACCCACAACCAATTTATTCAGG + Intergenic
1048667925 8:136684994-136685016 AACCCAACATTTTTTTTTTCTGG - Intergenic
1055164544 9:73175694-73175716 AACCCAACATCATCCTTTACTGG - Intergenic
1055201726 9:73671464-73671486 AACCCAACCCCTTTTTCTTCAGG + Intergenic
1055205735 9:73728216-73728238 AACCCAAAGCCATTATTTTCTGG - Intergenic
1060001197 9:119960093-119960115 AACTGACCACCCTTTTTTTCTGG - Intergenic
1188967853 X:36577360-36577382 TACCCAACACCTTTGTTTTGGGG + Intergenic
1191879107 X:65826923-65826945 GACCCAATATCATTTTTTGCTGG + Intergenic
1194001119 X:88429886-88429908 AACCATACACATTTTTTTTCAGG - Intergenic
1198104461 X:133449035-133449057 AACCCAATGGCATTTTTTTTAGG - Intergenic
1199253525 X:145692608-145692630 AGCCCAGCTCCATTTTTATCTGG - Intergenic
1201611767 Y:15851205-15851227 CACCCACCCCCATTTTTTTTTGG + Intergenic
1201951071 Y:19564679-19564701 ATCCTAACACCATTTGTTTAAGG - Intergenic