ID: 1022583090

View in Genome Browser
Species Human (GRCh38)
Location 7:31576686-31576708
Sequence TGTAGGTAAAAGAAAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 7, 3: 214, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022583090 Original CRISPR TGTAGGTAAAAGAAAAAGGT AGG Intronic
901263682 1:7892786-7892808 TTTAAGTGAAAGACAAAGGTGGG - Intergenic
901339444 1:8482281-8482303 TTTAGGGAAAAGAAGAAAGTGGG + Intronic
901485703 1:9559532-9559554 TAGAGGCAAAAAAAAAAGGTGGG + Intronic
901536748 1:9887414-9887436 TGAAATTAAAAGAAAAATGTGGG + Intronic
902774483 1:18666010-18666032 TGTAGAAAAAAGAAAGAGGCTGG + Intronic
903219132 1:21859345-21859367 TGAGGGCAAAAGAAAAGGGTGGG - Intronic
903909814 1:26715090-26715112 TGTAGATAAAATAAAAAGAATGG + Intronic
904879040 1:33680681-33680703 TGTAGGGAAAAGAGAATGGGGGG - Intronic
905087085 1:35390404-35390426 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
906067131 1:42989353-42989375 TGTCTCTAAAAGAAAAAAGTTGG - Intergenic
906619782 1:47266643-47266665 TGAAGGTAAAAGAAAAATGTAGG - Intronic
907503915 1:54903328-54903350 GGTAGGTAAAGGAAAAAAGGGGG + Intergenic
908084089 1:60611636-60611658 AGTAGGGAAAAGGAAAAGATTGG + Intergenic
908096216 1:60741696-60741718 TGTAGGTAAAGGAAAGACGGGGG - Intergenic
908429559 1:64042593-64042615 TGAAGGTAAAAGCAGGAGGTGGG - Intronic
908760159 1:67504367-67504389 TGTAGGTTAAAGAATGAGGTTGG + Intergenic
909658811 1:78060111-78060133 TATAGGTAAAGGATATAGGTGGG + Intronic
910071152 1:83214925-83214947 AGTGGGGAAAAAAAAAAGGTGGG - Intergenic
910233671 1:85012299-85012321 TTTAAGAAAAAAAAAAAGGTGGG + Intronic
910586854 1:88890213-88890235 TGTAGGTAAATGGAAAACTTGGG - Intronic
910912285 1:92249491-92249513 TATCAGTAAAAGAAAAAGGCTGG - Intronic
911016902 1:93343553-93343575 TCTAAGTAAAAAAAAAAGCTGGG + Intergenic
911510124 1:98801195-98801217 GGTAGGTGAAGGAAAAAGGGGGG + Intergenic
911510914 1:98806555-98806577 GGTAGGTGAAGGAAAAAGGGGGG + Intergenic
911725192 1:101235881-101235903 TCTAAGCAAAAGAAAAGGGTGGG + Intergenic
911730712 1:101289563-101289585 TGTTAATAAAAGAAAGAGGTGGG - Intergenic
911759194 1:101597371-101597393 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
911760055 1:101603236-101603258 GGTAGATAAAGGAAAAAGGGGGG + Intergenic
911987652 1:104650312-104650334 TGTAAATAAAAGAAAAGAGTAGG + Intergenic
912254278 1:108043228-108043250 TGTAGGAAAAAGAGAAAAGAAGG - Intergenic
912348588 1:108989568-108989590 GGTAGATAAGAGAAAAAGGGAGG + Intronic
914714426 1:150242416-150242438 TGCAGTTTAAAGATAAAGGTAGG + Intergenic
915565484 1:156710514-156710536 TGGAGGAAGAAGGAAAAGGTTGG + Intergenic
916164097 1:161949430-161949452 TGGAGGACAAAGAAACAGGTTGG - Intronic
917065697 1:171090964-171090986 GGTAGGAAAATTAAAAAGGTAGG + Exonic
917910611 1:179641098-179641120 TGAAGGAAAAATAAAAAGTTAGG - Intronic
918862846 1:189855216-189855238 TGTAAGTAAAAGAATAAAGCTGG - Intergenic
918865278 1:189889723-189889745 TGTAGGTAAAAGAGAGAATTAGG - Intergenic
918882450 1:190142824-190142846 TTTAGGGAAAAAAAAAAAGTTGG + Intronic
919217526 1:194578485-194578507 TCGAGTTAAAAGGAAAAGGTTGG - Intergenic
919577519 1:199330149-199330171 TGTCATTAAAAGAAAAAGTTGGG - Intergenic
919762631 1:201107650-201107672 TGTAGGTAGCAGAGAAGGGTTGG - Intronic
920586497 1:207168333-207168355 TGTATGTAACAGGAAAAGATTGG - Intergenic
920617867 1:207511670-207511692 TGTCGGTAAAAGAAATAGGAAGG - Intronic
921178652 1:212614479-212614501 TGGAAGTAAAAGCAAAAAGTGGG - Intronic
921646689 1:217626979-217627001 TCTAGGGAAAAAAAAAAGGCTGG + Intronic
922334433 1:224607211-224607233 TGTAAATAAAAGAAAATGGTGGG + Intronic
922414448 1:225407727-225407749 TCTAGGTTAAAGAAAAAGAGTGG + Intronic
922613116 1:226944421-226944443 TGAAGGCAAAAGAAAAAAATAGG + Intronic
922875801 1:228938957-228938979 TGTGGCTAAAAGCAAGAGGTCGG - Intergenic
923021542 1:230167863-230167885 AATAGGTAAGAAAAAAAGGTGGG - Intronic
923734699 1:236594307-236594329 TTTAGATAAAAGAAAAATGAAGG - Intronic
923962434 1:239101463-239101485 GGTAAGTAAAGGAAAAAGGGAGG - Intergenic
923963254 1:239106900-239106922 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
924079331 1:240377671-240377693 TGTAAGTGAAAGAGAAAGGTAGG - Intronic
924180291 1:241434127-241434149 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
924181158 1:241439720-241439742 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1062930479 10:1349256-1349278 GGTAGGTAAAGGAAGAAGGGGGG - Intronic
1062931276 10:1354407-1354429 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1063344623 10:5299446-5299468 TGTAGGGAACAGAAGAGGGTAGG - Intergenic
1064100630 10:12460990-12461012 GGTAGATAAAGGAAAAAAGTAGG + Intronic
1064731666 10:18337400-18337422 AGTAAATAAAAGAAAAAAGTAGG - Intronic
1065474999 10:26126108-26126130 TGTAGGTAATAGTAAATGGCAGG + Intronic
1065634060 10:27712496-27712518 AGGAGGTAAAAGGAAAAGGTGGG + Intronic
1065715563 10:28563978-28564000 TGAAAGTAGAAGAAAAAGGCTGG + Intronic
1065920813 10:30391394-30391416 TGGAGGTAATAGAAAATGCTTGG - Intergenic
1067909969 10:50336320-50336342 AGAAAGTAAAAGAATAAGGTTGG + Intronic
1068129029 10:52874510-52874532 TGTAGGCAAAGTAAAAATGTGGG + Intergenic
1068773888 10:60851131-60851153 TATAGGTGAAAGAAAGAGGCAGG - Intergenic
1068883399 10:62074331-62074353 TTATGGTAAAAGCAAAAGGTTGG - Intronic
1069001019 10:63265117-63265139 TACAGTTAAAAAAAAAAGGTGGG - Intronic
1069612180 10:69781530-69781552 TGGAGGTCAAAGACACAGGTGGG + Intergenic
1069838369 10:71323806-71323828 TCCAGGTAGAAGAAAAAGGCTGG + Intronic
1070089060 10:73266423-73266445 TGAAGGTAAAAGGATTAGGTAGG - Intronic
1071168880 10:82840177-82840199 TGTAGGAAACTGACAAAGGTAGG + Intronic
1071935355 10:90524786-90524808 TGGAGGTAAGAGAAAGAGATAGG - Intergenic
1072332379 10:94366269-94366291 TGTGGGTAAAAGAAAGAAATAGG - Intergenic
1072413652 10:95229375-95229397 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1072665133 10:97387274-97387296 TTCAGGAAAAAGAAAATGGTTGG - Intronic
1072845003 10:98819599-98819621 TTTAGGTTAAAGACAAAAGTAGG - Intronic
1073008372 10:100341519-100341541 TGTAGGTGAAAGGAACAGGCAGG - Intergenic
1073273118 10:102283741-102283763 TGTAGGTAGGGGAAAAACGTGGG + Intronic
1073981305 10:109156843-109156865 TTCAGTTAAAAGAAAAAGCTGGG - Intergenic
1074214002 10:111366336-111366358 TGGATGTAAAAAAAAAAGGGGGG + Intergenic
1074389062 10:113041869-113041891 TGTAGCTAAAAAATAAATGTGGG - Intronic
1075160491 10:120020445-120020467 TGAAGGTTAAAGAAAGAAGTAGG + Intergenic
1075912981 10:126141940-126141962 GCTGGCTAAAAGAAAAAGGTTGG - Intronic
1076716919 10:132370778-132370800 TGTAGGCAGCAGAAAAAGGGAGG - Intronic
1077590174 11:3484979-3485001 TGTAGGTAAAGGAAAATGGGGGG + Intergenic
1077676156 11:4194378-4194400 TTTAAGTCAAAGAAAAATGTAGG - Intergenic
1077727282 11:4687329-4687351 TGTAGGTAAGAGTAAAAATTAGG - Intronic
1078032107 11:7763172-7763194 TGTAGGTAAAGTGAAAAGGAAGG - Intergenic
1078122523 11:8523887-8523909 TGTGGGAAAAAGAAAGAGATCGG + Intronic
1079726622 11:23887402-23887424 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1079727428 11:23892665-23892687 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1079962007 11:26936085-26936107 TGTACATACAAGAAAGAGGTGGG + Intergenic
1080576222 11:33601756-33601778 TTTACATAAAAGAAAAAGATTGG - Intronic
1082236772 11:49826964-49826986 TCTATGCAAAAGAAAATGGTAGG - Intergenic
1082241926 11:49882737-49882759 TCTATGCAAAAGAAAATGGTAGG + Intergenic
1082656428 11:55863673-55863695 TCTATGCAAAAGAAAATGGTAGG + Intergenic
1083151447 11:60794231-60794253 TGTAGGGGACAGAAACAGGTTGG - Intronic
1083578462 11:63809679-63809701 TGTAGGCAAAATAAATTGGTTGG + Intergenic
1083920456 11:65779384-65779406 TGAAGGTAAAAGAGATGGGTGGG + Exonic
1084245897 11:67856753-67856775 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1084826776 11:71737761-71737783 GGTAGGTAAACGAAAAAAGGGGG - Intergenic
1084828840 11:71752531-71752553 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1084885205 11:72199859-72199881 AATAAGTAAAAGAAATAGGTCGG - Intergenic
1085234083 11:74998563-74998585 TGTAGGTAAAAAAGCAGGGTAGG - Intronic
1085932326 11:81098433-81098455 TTCAGGTAAAAAAAAAAGGGAGG + Intergenic
1085937113 11:81160083-81160105 TGTAGGTGACAGAAAAATGTTGG + Intergenic
1086494226 11:87385574-87385596 TGGGGGGAAAAGAAAAAGGAAGG + Intergenic
1087098770 11:94345962-94345984 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1087100124 11:94355372-94355394 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1090527105 11:127548211-127548233 GGTAGGTAAAGGAAAAAGTGGGG + Intergenic
1090546001 11:127769061-127769083 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1090546816 11:127774642-127774664 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1090942894 11:131404084-131404106 TGTAGCTAAAGGAAGAAGGGAGG - Intronic
1091929607 12:4384308-4384330 TCAAGGTAAAAAAAAAAGCTGGG + Intergenic
1092311362 12:7358279-7358301 TAAAGGTAAAACAAAAATGTAGG - Intronic
1092414403 12:8279165-8279187 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1092478110 12:8836335-8836357 TGTAGGTAAGAGCAGAAGCTTGG + Exonic
1092789370 12:12058619-12058641 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1092790168 12:12063918-12063940 GGTAGGTAAAGGAAGAAGGGGGG - Intronic
1092925149 12:13265260-13265282 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1093135790 12:15448981-15449003 TATTGATAAAAGAAAAAGTTAGG + Intronic
1093194093 12:16109785-16109807 TTTATGTGAAAGAAAAAGCTAGG + Intergenic
1093546438 12:20354396-20354418 TATATTTAAAAGAAAAAGGCAGG + Intergenic
1093749325 12:22780228-22780250 TGAAGTTAAAAGAAAATGTTAGG + Intergenic
1093909892 12:24734592-24734614 TGGAGAAAAAAGAAAAAGATGGG + Intergenic
1094149713 12:27269562-27269584 TGTAGCCAAAAGAAAAAAGCTGG - Intronic
1094315506 12:29134751-29134773 GGTAGGTAAAGGAAAAAAGGGGG + Intergenic
1094316396 12:29140497-29140519 GGTAGGTAAAGGAAAAAGAGGGG + Intergenic
1094329458 12:29275207-29275229 GGTAGGTAAAGGAAAAAGGTGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095085936 12:38057395-38057417 AGAAAGAAAAAGAAAAAGGTGGG + Intergenic
1096794380 12:54066067-54066089 TATAGGAAAAAGAAAAAGAAGGG - Intergenic
1096875206 12:54624495-54624517 TGAAGGGAAAAGAAATAGATCGG - Intergenic
1097231954 12:57518116-57518138 TGGAGGTAAAAGAAAAATAAGGG - Intronic
1097550145 12:61057708-61057730 TGTGGGTAAAATAAAAAAGATGG + Intergenic
1097570894 12:61330169-61330191 TGTAAGTAAAAGGAAACTGTGGG + Intergenic
1098081773 12:66794005-66794027 TGTGTTGAAAAGAAAAAGGTAGG + Intronic
1098508128 12:71279094-71279116 TGTAAGTAAAAAAATAAGTTAGG + Intronic
1098903123 12:76133127-76133149 TAAAAGAAAAAGAAAAAGGTGGG - Intergenic
1098949739 12:76627578-76627600 AGTAGGTAGAAGAAGAATGTTGG + Intergenic
1099105414 12:78489795-78489817 TGAAGGTAGAAGAGAAAGGATGG + Intergenic
1099328023 12:81244621-81244643 TGTAGGTGAAAGAAGAATCTTGG - Intronic
1099666350 12:85634485-85634507 TGTAAGTAAAAGCTAAAGATCGG - Intergenic
1099824124 12:87752725-87752747 TGTGGGTAAATGAATATGGTAGG + Intergenic
1099983705 12:89637692-89637714 TGAAAGTAAAAGATAAAGCTGGG - Intronic
1100273549 12:93049120-93049142 TGTTGGTAAATGTAAAAGGATGG + Intergenic
1101374939 12:104163489-104163511 TGAAGGTAAAAAAAAAGAGTAGG - Intergenic
1101595599 12:106161984-106162006 TATAGGTAAAAAAAAAAGAAAGG + Intergenic
1102055078 12:109890491-109890513 AATAGAAAAAAGAAAAAGGTTGG - Intergenic
1102135633 12:110572064-110572086 TTGAGGTAAATGCAAAAGGTTGG - Intronic
1102172969 12:110856039-110856061 GGTTGGTAAAAGCAAAAGGAAGG - Intronic
1103344989 12:120243341-120243363 TTTAAGTAAAGGACAAAGGTTGG + Intronic
1103772545 12:123339354-123339376 AGTAGGCAAAAGAGAGAGGTTGG - Intronic
1103867349 12:124063659-124063681 TTTAGGGAAAAGGCAAAGGTTGG - Intronic
1104187339 12:126445432-126445454 TGGAGGTCAAAGACGAAGGTGGG + Intergenic
1105264555 13:18804498-18804520 AGTGGGTAAAAGACAGAGGTAGG - Intergenic
1105589442 13:21777660-21777682 TGAAAGCAAAAGAAAAAGATAGG - Intergenic
1105693621 13:22866231-22866253 TGTAGGTAAAAAAAAACTGAGGG + Intergenic
1105785321 13:23742398-23742420 TCTAAGTAAAAGTAAAATGTTGG + Intronic
1106048698 13:26169500-26169522 TGTAGGACACAAAAAAAGGTAGG - Intronic
1106490780 13:30219639-30219661 TATAGATAAAAGAAAAAGAATGG + Intronic
1106743768 13:32677197-32677219 TGTATTTAAAAGAAAAAAGTTGG - Intronic
1107219796 13:37969149-37969171 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1108340018 13:49489913-49489935 TTTATGTAAAAAAAAAAGGGGGG - Intronic
1108490198 13:50974377-50974399 GGAAGGAAAAAGAAAAAGGAGGG + Intergenic
1108900152 13:55392611-55392633 TGTAGGTAAAGAAAAATGATGGG - Intergenic
1109341563 13:61067318-61067340 TGGAGCTAAAAGAAAAGGGTGGG + Intergenic
1109352740 13:61205919-61205941 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1109353466 13:61211116-61211138 GGTAGGTAAAGGATAAAGGGGGG - Intergenic
1109614825 13:64818739-64818761 TGAAGGAAAAAGAAAGATGTTGG + Intergenic
1110060359 13:71032415-71032437 TGAAGGTAAAAGAAAACAGCTGG + Intergenic
1110412940 13:75223184-75223206 TGTTGGTTAAATAAAATGGTGGG - Intergenic
1110434472 13:75463927-75463949 TGTAGCCAAAAGAAAGAGATGGG - Intronic
1111254919 13:85654000-85654022 TGGAGCAAAATGAAAAAGGTAGG - Intergenic
1111573285 13:90116164-90116186 TGTAGAGAAAGGAAAAAGGTAGG + Intergenic
1111739892 13:92190999-92191021 TGTAGATTAAAGCAAAAGGATGG + Intronic
1111776923 13:92675575-92675597 TATAGTTAAAAAAAAAAGGAGGG - Intronic
1112156020 13:96817633-96817655 TGCAACCAAAAGAAAAAGGTGGG - Intronic
1112236501 13:97642550-97642572 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1112237324 13:97648044-97648066 GGTAGGTAAAGGAAAAAAGGGGG - Intergenic
1112767221 13:102758361-102758383 TGAAGCTAAATGAAATAGGTTGG - Intronic
1112895952 13:104300491-104300513 TGTAGAAAAAAGGAAAATGTAGG + Intergenic
1113461746 13:110486739-110486761 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
1114814859 14:25945204-25945226 TTTAGGGAAAAGGAACAGGTGGG - Intergenic
1114848011 14:26347518-26347540 TATAGGACCAAGAAAAAGGTGGG - Intergenic
1115671388 14:35616248-35616270 GGCAGGTAAAAGAAAAATGAGGG + Intronic
1116113710 14:40620814-40620836 TGTAGGTAAACGAAAATTGATGG + Intergenic
1116344936 14:43780983-43781005 TGAAGGTGGAAGAAAACGGTTGG + Intergenic
1116490062 14:45495058-45495080 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1116747431 14:48838621-48838643 TGTATGTATAAGTAAAAGGCAGG - Intergenic
1117149762 14:52873480-52873502 TGCAGGTAGATGAGAAAGGTGGG + Intronic
1117683435 14:58228616-58228638 TGTAGGCAAAAGTAATATGTCGG - Intronic
1117957413 14:61133383-61133405 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1117958255 14:61138904-61138926 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1118939878 14:70323824-70323846 TTTAGGTAAAACAGGAAGGTTGG + Intergenic
1119469124 14:74882520-74882542 TGTACTTAAAAGAAAAAGCTGGG + Intronic
1119746094 14:77045185-77045207 TGTAGGGAAAGGAAAAAGAAAGG - Intergenic
1120265562 14:82245595-82245617 TGTAGGTAGAATGAACAGGTGGG + Intergenic
1122011988 14:98758156-98758178 TGTAGGTTAATAAAAAAGGAAGG + Intergenic
1122424854 14:101599960-101599982 TGTAGATAAAGGAATAAGGGTGG + Intergenic
1123200616 14:106660111-106660133 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1123882770 15:24690767-24690789 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1124317029 15:28678917-28678939 GGGAGGTAAAAGCAAAAGGGAGG + Intergenic
1124874833 15:33582082-33582104 TTTGGTGAAAAGAAAAAGGTGGG + Intronic
1124967253 15:34444146-34444168 TGAGGGGAAAAGAGAAAGGTTGG - Intergenic
1125158459 15:36616265-36616287 TGAAAGAAAAAGAAAAATGTAGG - Intronic
1125562746 15:40649588-40649610 TTTAAATAAAAGAAAAAGGCAGG - Intronic
1126439924 15:48676346-48676368 TCTGGTTAAAAAAAAAAGGTTGG - Intergenic
1127652473 15:61022778-61022800 TGGAGGTAGAAGAAAATGGTAGG + Intronic
1127779206 15:62296708-62296730 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1128286104 15:66438385-66438407 TGTAAGAAAAATAAAAAGATTGG - Intronic
1129218911 15:74119932-74119954 TGGAGGTAATAGAAAACGCTTGG - Intronic
1129506002 15:76081938-76081960 TTGAGGTAAGAGAAAAGGGTGGG - Intronic
1130209867 15:81913047-81913069 TGAAGGGAAAAGTAAAAAGTTGG - Intergenic
1130781577 15:87045379-87045401 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1130925233 15:88380575-88380597 TGTAGGTAAAGAATTAAGGTAGG + Intergenic
1131190123 15:90308067-90308089 TGTAGGTAAAAGGTAAAGATTGG + Intronic
1131849348 15:96522382-96522404 TGGAGGTAAAAGAACAAAGCTGG + Intergenic
1132242750 15:100271912-100271934 TGTATGCAAAAGAACAAAGTTGG - Intronic
1132263526 15:100446037-100446059 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1134761953 16:16722413-16722435 TGTAATTAAAAGAAAAAAGGTGG + Intergenic
1134984105 16:18636757-18636779 TGTAATTAAAAGAAAAAAGGTGG - Intergenic
1135727360 16:24866603-24866625 TGAAAGTAAAAGTAAAAGGATGG + Intronic
1137806041 16:51306377-51306399 TGAAGGGAAAAAAAAAAGGAAGG - Intergenic
1138072561 16:54007661-54007683 TGGAGATAAAAGAAAGTGGTAGG + Intronic
1138224224 16:55278761-55278783 TTTAGGTGAAAGGAAGAGGTGGG + Intergenic
1138355169 16:56372007-56372029 TTAAGGTAAAAAAAAAAGATGGG - Intronic
1140782701 16:78311117-78311139 TGTGGGTTAAAGAAAAAGAAAGG + Intronic
1141065872 16:80913229-80913251 TGTTGGTAAAAGCAGATGGTAGG + Intergenic
1144169702 17:12648078-12648100 GGTATGTAAAAGAAGAAGGAGGG - Intergenic
1145770348 17:27488465-27488487 TGTTGGTAACAGCAAAAGATTGG - Intronic
1147264475 17:39226203-39226225 TGCAGGGAATAGAAATAGGTTGG + Intergenic
1148412473 17:47479633-47479655 TGGAGGGGTAAGAAAAAGGTTGG + Intergenic
1148620728 17:49032688-49032710 GGTATCTAAAAGAAAATGGTAGG - Intronic
1149214815 17:54341704-54341726 AGTATGAAAAAGAATAAGGTAGG + Intergenic
1149219139 17:54395097-54395119 TGTAGGTTAAATTAAAAGTTGGG + Intergenic
1149482812 17:57017362-57017384 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1149546418 17:57507096-57507118 TGGAGGTAAAATAAAAGGGAGGG - Intronic
1150178996 17:63094998-63095020 TGAAGTTAAAAAAAAAAGGCGGG - Intronic
1150436616 17:65159183-65159205 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1152398328 17:80048775-80048797 TGTAGGCAAAAGCAAAACCTGGG - Intronic
1153171248 18:2318649-2318671 TGAAGTTAAAATAAAAAGGCTGG - Intergenic
1153262058 18:3234005-3234027 TCTGGGTAAGAGGAAAAGGTAGG - Intergenic
1153386975 18:4509829-4509851 CGTGGGGAAAAGAAAAAGGTAGG + Intergenic
1153600282 18:6774300-6774322 TTTATGTAAAAGAGAAAGGAAGG + Intronic
1154048767 18:10933225-10933247 TGTAAGTTAAGGAAAAAGCTAGG - Intronic
1155174364 18:23289882-23289904 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1155467362 18:26152623-26152645 TGCAGGTAAAAGAATAATGCAGG - Intronic
1155941209 18:31804020-31804042 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1155942084 18:31809894-31809916 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1156237081 18:35216246-35216268 GGTAGGTAAAGGAAAAAAGGGGG - Intergenic
1156237979 18:35222349-35222371 GGTAGGTAAAGGAAAAAAGTGGG - Intergenic
1156301963 18:35844337-35844359 GGTAGGTAAAAGAAAAAGGGGGG - Intergenic
1156338553 18:36190041-36190063 TGCAGGAAAAACAAAAGGGTGGG - Intronic
1156836001 18:41555829-41555851 TGGAGGAAAATGAAAAAGGTGGG - Intergenic
1156938289 18:42737274-42737296 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1156938987 18:42742183-42742205 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1157055229 18:44220231-44220253 TGTATGTAAAAGAAACAGTTGGG + Intergenic
1158352658 18:56578732-56578754 TGGAAGTAAAATAAAAATGTGGG - Intergenic
1158448142 18:57539023-57539045 AGTAGATAAAAGAAAAATGGAGG + Intergenic
1158454988 18:57598152-57598174 TATAGGGAAAATAAAAAGTTGGG + Intergenic
1158499013 18:57983316-57983338 TGAAGGTAAAAGGAGAAGTTAGG + Intergenic
1159033375 18:63253965-63253987 AGAACGTAAAAGAAACAGGTGGG - Intronic
1159164142 18:64681968-64681990 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1159164952 18:64687160-64687182 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1159210167 18:65309081-65309103 TGTAGGTTAAACAGAAATGTTGG - Intergenic
1159571304 18:70115986-70116008 TTAAGATAAAAGAAAAAGTTGGG - Intronic
1159575801 18:70175254-70175276 TCTAGGTAAAATAGAAAAGTAGG + Intronic
1160497858 18:79385634-79385656 AGTAGTTTAAAGAAAAATGTTGG + Intergenic
1162196020 19:8985384-8985406 TGGAGGTTAAATAAAAAGTTAGG + Intergenic
1162218810 19:9158777-9158799 TGTTGGAAAAGGAAAATGGTGGG - Intronic
1163564158 19:18039922-18039944 TCTAAGTAAAAAAAAAAGGTTGG + Intergenic
1164075639 19:21815603-21815625 TGTAGGTAAAAGAGAATGATAGG - Intronic
1164159191 19:22615673-22615695 TGAAGGAAAAAGAAAAGGGGGGG + Intergenic
1164250028 19:23468153-23468175 GGAAGGGAAAAGAAAAAGGGGGG - Intergenic
1165184903 19:34009840-34009862 CATAGGTAAAAGTAAAAGGATGG + Intergenic
1165535144 19:36438127-36438149 TTTACTTAAAAGACAAAGGTGGG + Intergenic
1165926489 19:39329284-39329306 TCTAGGTGAAAGGAAAAGGTGGG + Intronic
1166250504 19:41566145-41566167 TAAAGGCAAAAGACAAAGGTGGG + Intronic
1166429519 19:42712482-42712504 TGTAAGTGAAAGAGAAAGGCAGG + Intronic
1166468982 19:43061024-43061046 TGTAAGTGAAAGAGAAAGGCAGG + Intronic
1167099098 19:47393105-47393127 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1167099940 19:47398592-47398614 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1167525059 19:49978529-49978551 TGTTGGTAAAATAAAAATCTGGG + Intronic
1167535578 19:50049132-50049154 TGTCACTAAAGGAAAAAGGTGGG - Intronic
1167901818 19:52628030-52628052 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1167902606 19:52633232-52633254 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
1167972992 19:53200448-53200470 TGTAGGAAAAAGAAACTTGTAGG - Intergenic
1168104725 19:54159760-54159782 AGTAGGGACAAGAAAAAGGGGGG - Exonic
1168131311 19:54321387-54321409 GGTAGGTAAAGGAAAAAGAGGGG + Intergenic
1168188110 19:54714463-54714485 TGGAGGGAAAAGAAAAAAATAGG + Intergenic
1168465974 19:56601483-56601505 TGTAGGGAGAAGAAAGAGGGAGG - Intronic
1168577892 19:57528233-57528255 TTCAGGTAAAAGAAAAACTTGGG - Intronic
926117315 2:10221665-10221687 TGCAGGAGAAAGAAAAAGGCAGG - Intergenic
926513616 2:13813061-13813083 TGTTGTTAAAAAAAAATGGTTGG - Intergenic
927424814 2:22970332-22970354 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
927531080 2:23802168-23802190 CACAGGTAAAAGAAAAATGTTGG + Intronic
927540444 2:23906034-23906056 TTTATCTAAAAGAGAAAGGTCGG + Intronic
928258904 2:29749381-29749403 TGTTTGTAAAAGACATAGGTTGG - Intronic
928827161 2:35437064-35437086 GGTAGGTAAAAGAAAAAGGGGGG + Intergenic
928827936 2:35442328-35442350 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
929076210 2:38080942-38080964 GGAAGGTAAAGGAAAAAGGGGGG + Intronic
929077034 2:38086253-38086275 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
929271016 2:39971909-39971931 GTTTGGTAAAAGAAAAAGATAGG - Intergenic
929287921 2:40156493-40156515 ATTAGGTAAAAGAAAGAGGGAGG + Intronic
929299061 2:40281243-40281265 TGTATTTAAAAAAAAAGGGTTGG + Intronic
929311073 2:40426149-40426171 TCTAGAAAAAAGAAAAATGTAGG + Intronic
929315831 2:40477426-40477448 TGTAGGACAAAGAAATAGGGAGG - Intronic
929485936 2:42354467-42354489 TGTCTGTAAAAGGAAAAGGCTGG - Intronic
929630382 2:43454128-43454150 TTTATTTAAAAGAAAAAAGTTGG - Intronic
930113440 2:47698420-47698442 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
930316209 2:49799928-49799950 TGGAGGTAGAGGAAAAAGCTAGG - Intergenic
930593747 2:53360165-53360187 TGTATGCAAAAGAATAAAGTTGG - Intergenic
931043075 2:58319224-58319246 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
931244613 2:60481670-60481692 TGTGGGGAAAAGAAAGATGTAGG - Intronic
931354976 2:61528914-61528936 AATAGGTAAAAGAAATAGGAAGG - Intronic
931492315 2:62761855-62761877 TGAAAGGAAAAGAAACAGGTTGG - Intronic
931844286 2:66186609-66186631 TGGAGGTTAAAGCAAAAGGGAGG - Intergenic
931904714 2:66830066-66830088 TGTAGGTAAATAAAAATGTTTGG - Intergenic
931947906 2:67331754-67331776 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
931948740 2:67337439-67337461 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
931961713 2:67490015-67490037 AGGAGGTAAAAGAGAAAGGAAGG + Intergenic
932295480 2:70620733-70620755 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
933009797 2:77045983-77046005 TATAATTAAAAGAAAAAGGAAGG - Intronic
933163402 2:79051634-79051656 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
933164176 2:79056908-79056930 GGGAGGTAAAGGAAAAAGGGGGG - Intergenic
933544139 2:83688572-83688594 TATCAGTAAAAGAAATAGGTAGG - Intergenic
933798349 2:85939416-85939438 TTGAGATAAAAGAACAAGGTTGG + Intergenic
933846541 2:86331512-86331534 TGAAAGGAAAAAAAAAAGGTGGG + Intronic
934788742 2:97037783-97037805 TCTATGCAAAAGAAAAGGGTAGG - Intergenic
935310416 2:101777663-101777685 CATAGTTAAAAGAAAAAGGATGG - Intronic
935614641 2:105064535-105064557 GGTATGGAAAAGAGAAAGGTGGG + Intronic
937486872 2:122324498-122324520 TGTAGGGATAAGGAAAGGGTTGG - Intergenic
937567433 2:123311750-123311772 TGTAAGTTAAAAAAAAAGGAGGG - Intergenic
937620511 2:123979933-123979955 AGAAGGAAACAGAAAAAGGTGGG + Intergenic
937701471 2:124867364-124867386 TATGGGTATAAGAAAAAGGTAGG - Intronic
937710427 2:124974713-124974735 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
937760967 2:125603298-125603320 AGTAGGTAATAGACAGAGGTTGG + Intergenic
937827469 2:126382340-126382362 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
938154396 2:128920199-128920221 TGTAGGCAAAAATGAAAGGTAGG - Intergenic
938280203 2:130058566-130058588 AGTGGGTAAAAGACAGAGGTCGG - Intergenic
938331161 2:130449281-130449303 AGTGGGTAAAAGACAGAGGTCGG - Intergenic
938358790 2:130672222-130672244 AGTGGGTAAAAGACAGAGGTCGG + Intergenic
938435181 2:131278883-131278905 AGTGGGTAAAAGACAGAGGTCGG + Intronic
938665794 2:133534995-133535017 TATAGTTAAAAAAAGAAGGTGGG - Intronic
938916497 2:135946476-135946498 TTTAGATAAAAGAAAAAAGCAGG + Intronic
939096051 2:137834710-137834732 TGTAGAAAACTGAAAAAGGTAGG - Intergenic
939327685 2:140715021-140715043 TGCAGGTAAAAGGAAGAGGTTGG + Intronic
939387806 2:141523633-141523655 TTTACGTTAAAGAAAAAGGAAGG - Intronic
939431721 2:142118068-142118090 TGCAGGCAAAAGAAAATGATTGG - Intronic
939787995 2:146540130-146540152 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
939797854 2:146669362-146669384 ATTAGGTAAAAGAAAATGTTGGG - Intergenic
941028839 2:160489065-160489087 TGAAGGGAAAAGGAAAAGATAGG - Intronic
941168116 2:162105080-162105102 TGAAGGCAGAAGCAAAAGGTTGG - Intergenic
941387373 2:164869954-164869976 TGTAAGTATAAGAAAATGGTAGG - Intergenic
941677139 2:168355895-168355917 TGTAGGAAATAGAACAAGGTGGG - Intergenic
941936229 2:170983126-170983148 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
942172834 2:173304329-173304351 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
942189600 2:173456969-173456991 TGGAGGGAAAGGGAAAAGGTGGG + Intergenic
942544507 2:177049076-177049098 TTTAGGTAAAAGAAAAAAAAAGG + Intergenic
942629215 2:177937991-177938013 TGGAGGTCAAAGAAAAATATTGG - Intronic
942729798 2:179051729-179051751 GGTAAGTAAAGGAAAAAGGGGGG + Intergenic
942730591 2:179057071-179057093 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
943370205 2:187007023-187007045 TGTTGTTAAAAGAAAAAAGTGGG + Intergenic
943658831 2:190535970-190535992 AGTAGCTAAAATAAACAGGTGGG + Intergenic
943865080 2:192918560-192918582 GGTAGGTAAAGGAAAAAAGGGGG - Intergenic
943865949 2:192924675-192924697 GGTAGGTAAAGGAAAAAAGGGGG - Intergenic
943971667 2:194416359-194416381 TCTAGTTAAAAGAAAAAACTTGG - Intergenic
944569010 2:201024002-201024024 AGAAGGTAAAAGAAAATGCTGGG - Exonic
945096933 2:206229152-206229174 TCTCGGGAAAAAAAAAAGGTTGG + Intergenic
945360792 2:208894005-208894027 GGTATGTAAAGGAAAAAGGGGGG - Intergenic
945362155 2:208905309-208905331 GGTAGGTAAAGGAAAAAGTGGGG - Intergenic
945864726 2:215163158-215163180 TGTGGGGAAAAGAAAGAGATCGG - Intergenic
946230593 2:218288802-218288824 GGTGGGTAAAAGAAAAGGGAGGG + Intronic
946284661 2:218693890-218693912 TGTAGGTAAAAGTAGTAGATTGG + Exonic
946547600 2:220761910-220761932 TGGAAGTAAAAGAAAAAGTTTGG - Intergenic
946780413 2:223188914-223188936 GGTAGGTAAAGGAAAAAGTGGGG + Intronic
946781374 2:223195244-223195266 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
946886967 2:224230825-224230847 GGTAGGTAAAGGAATAAGGGGGG - Intergenic
947078606 2:226370587-226370609 TGTTGGTAAAAACAAATGGTGGG + Intergenic
948110699 2:235453354-235453376 TCTAGGGAAAAGTAAGAGGTAGG - Intergenic
1168867952 20:1105208-1105230 TGTAGGTCAAAGAAAAGACTGGG - Intergenic
1169242026 20:3990472-3990494 TGTTTATAAAAGCAAAAGGTTGG + Intronic
1170324996 20:15147837-15147859 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
1170325823 20:15153294-15153316 GGTAGGTAAATGAAAAAGGGGGG + Intronic
1170474078 20:16697520-16697542 TGTAGGTAAAAGAATGACTTAGG - Intergenic
1170676663 20:18488229-18488251 TGTTGGGAAATGAAAAAGGGTGG + Exonic
1170785082 20:19460763-19460785 AGTAGGTAAAAGAACAAGGGAGG - Intronic
1172070561 20:32253846-32253868 TGTATGTAATAGAAATATGTAGG - Intergenic
1173527877 20:43746801-43746823 TGAAGGGAAAAAAAAAAGGTGGG + Intergenic
1173722683 20:45273198-45273220 TGTAGAAAAAAGGAGAAGGTTGG - Intergenic
1175408978 20:58753584-58753606 AGTAAGAAAAAGAAAAAGGAGGG + Intergenic
1175607077 20:60319887-60319909 TGTATGCAAGAGAAAAATGTAGG - Intergenic
1176849633 21:13902945-13902967 AGTCGGTAAAAGACAGAGGTAGG - Intergenic
1177080303 21:16631290-16631312 GGTAGGTAAAGGAAAAAGTGGGG - Intergenic
1177101140 21:16898076-16898098 GATAGGTAAAGGAAAAAGGGGGG - Intergenic
1177103175 21:16919734-16919756 GTTAGGTAAAGGAAAAAGGGAGG - Intergenic
1177497509 21:21909259-21909281 GGTAGGAAAAAGAATAAGATTGG + Intergenic
1177567291 21:22841697-22841719 TTTAAGTAAGAAAAAAAGGTAGG + Intergenic
1177840245 21:26228025-26228047 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1177841009 21:26233226-26233248 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1178042210 21:28651823-28651845 TTTAAATAAAAGAAATAGGTGGG + Intergenic
1178055817 21:28797293-28797315 TGTATCAAAAAGAAAAAGGAAGG + Intergenic
1178846634 21:36179538-36179560 TGTAGGTAATAGCAAAAAATTGG + Intronic
1179649848 21:42800989-42801011 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1179650649 21:42806274-42806296 GGTAGGTAAAGGAAGAAGGGGGG + Intergenic
1183365729 22:37405817-37405839 TTTAGGAAAAAAAAAAAGGGTGG + Intronic
1184721542 22:46317266-46317288 TGTAGCTCAAGGAAAAAGGCTGG - Intronic
949112737 3:281854-281876 TATAGGAAAAAGAAATAGGCTGG - Intronic
949331357 3:2926496-2926518 AGTAGATTATAGAAAAAGGTAGG - Intronic
949654331 3:6199701-6199723 TTTTGGGAAAAGATAAAGGTGGG + Intergenic
949825321 3:8158863-8158885 GGAAGGTAAAAGAAAAGGGATGG + Intergenic
950617989 3:14177900-14177922 TGTGGACATAAGAAAAAGGTGGG + Intronic
951013065 3:17703280-17703302 TGTGGAGAAAAAAAAAAGGTAGG + Intronic
951299533 3:20977046-20977068 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
951584198 3:24198461-24198483 AGTAGTTAAAAAAAAAAGGGGGG - Intronic
951607326 3:24450676-24450698 TGTAGGTAAATGAAAAACTGGGG + Intronic
952027941 3:29106216-29106238 TGTTGGAAAAAGAAAAAGGAAGG + Intergenic
952246786 3:31602823-31602845 TATAAGTAAAAGAAACAAGTTGG - Intronic
952849009 3:37712516-37712538 TGTAGGTAAAAGAGAATGTAGGG + Intronic
953141113 3:40230292-40230314 TGTAAGCAATAGAAATAGGTAGG + Intronic
953177652 3:40566510-40566532 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
953332827 3:42068471-42068493 TGTAGTTAAGAGAAAAGAGTTGG + Intronic
953466547 3:43126651-43126673 TATGGGTAAATGAAAAAGGCAGG - Intergenic
953715477 3:45313573-45313595 AGTAGGTAAAGGAAAAAGGGGGG + Intergenic
953841385 3:46392609-46392631 TGTGGGTGAAAGATCAAGGTAGG + Intergenic
954062510 3:48080058-48080080 AGTGTGGAAAAGAAAAAGGTGGG + Intronic
954411154 3:50371773-50371795 AGGAGGAAAAAGAAAAAGGAGGG + Intronic
954971753 3:54657040-54657062 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
955028071 3:55189478-55189500 GCTAGGAAAAAGATAAAGGTCGG - Intergenic
955045598 3:55357084-55357106 TGTAGTTAAAAGCAAAATTTTGG - Intergenic
955206393 3:56899439-56899461 TGTACGTAGAAGAGAAAGATTGG - Intronic
955248533 3:57252934-57252956 TGTTGGTAAAAGATAAAAGTTGG + Intronic
955416162 3:58694016-58694038 TTAAGATAAAAAAAAAAGGTAGG - Intergenic
955529712 3:59860438-59860460 TGTAGGGAAAAGAAGGATGTTGG + Intronic
955702159 3:61692615-61692637 GGTAGGTAAAGGAAAAACGGGGG + Intronic
956357273 3:68407805-68407827 GGTATGTAAAGGAAAAAAGTAGG - Intronic
956847401 3:73196071-73196093 TAGAGGTTAAAGAAACAGGTGGG - Intergenic
957060224 3:75475475-75475497 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
957131476 3:76227876-76227898 TGTAGATAAAAATAAAAGCTTGG - Intronic
957286360 3:78222210-78222232 GTTAGGTAAAGGAAAAAGGGGGG - Intergenic
957907852 3:86580624-86580646 TATAGGTAAAAGAGAAAGTTGGG + Intergenic
958490748 3:94769017-94769039 TGGAGGTAAAACACAAAAGTAGG - Intergenic
959445094 3:106429319-106429341 TGTGGGAAAAAAAAAAAGCTAGG - Intergenic
959485299 3:106922907-106922929 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
959486089 3:106928123-106928145 GGTAGGAAAAGGAAAAAGGGGGG + Intergenic
959637174 3:108589000-108589022 AGTAGGTAACGGAAAAAGCTCGG - Intronic
959688785 3:109176542-109176564 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
960192082 3:114718809-114718831 TCTAGATAAAAGAAAAACCTTGG - Intronic
960329981 3:116347248-116347270 TGTATGCACAAGCAAAAGGTTGG - Intronic
960509780 3:118535444-118535466 TGTAGTTAAAAGTAAACAGTAGG + Intergenic
960850500 3:122047936-122047958 GGTAAGAAAAAGAAATAGGTGGG - Intergenic
960926413 3:122798998-122799020 TGCTGGTAAATGAAAAAGGGTGG - Intronic
961012392 3:123445199-123445221 AGTGGGTAAAAGAACAGGGTAGG + Intronic
961036453 3:123645690-123645712 TGTTTGTAAAAGCAAAAGGCTGG + Intronic
961293166 3:125863933-125863955 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
961572831 3:127812735-127812757 TGCAGGTAAGAGAGAAATGTGGG - Intronic
961658372 3:128455600-128455622 TGATGGTAAAAGAGAGAGGTGGG + Intergenic
961891951 3:130137783-130137805 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
961894021 3:130152482-130152504 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
961980471 3:131072747-131072769 TGTAGGTAAAAGAAGAGGGAAGG + Intronic
963180534 3:142350747-142350769 TGAGGGTAAAAGAGAAAGGAAGG + Intronic
963469073 3:145715931-145715953 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
964361854 3:155906975-155906997 AGTTAGTAAAAGAAAAAGGTGGG + Intronic
964983333 3:162712743-162712765 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
965079252 3:164017806-164017828 TGAAGGAAAAAGAAAAGGGCGGG + Intergenic
965205062 3:165712283-165712305 CATAGGTACATGAAAAAGGTGGG - Intergenic
965262143 3:166500744-166500766 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
965767941 3:172151462-172151484 TGTAGGAAAAAAAAAGAGGTTGG - Intronic
965774363 3:172213049-172213071 TGGAAGAAAAAGAAAAAGGAAGG - Intronic
966085110 3:176061601-176061623 GGTAGGTAAAGGAAAAAGGGAGG - Intergenic
966480113 3:180398222-180398244 TGAAGATAAAAGGAGAAGGTGGG + Intergenic
966945885 3:184776899-184776921 TGGAGGTAAAAGGAGTAGGTTGG + Intergenic
967152588 3:186663529-186663551 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
967210699 3:187165873-187165895 TGTAGGTAAAAGAAACTGCAAGG + Intronic
967321432 3:188198857-188198879 TGAAGGTAAAAGAAAGGGCTGGG + Intronic
967631290 3:191745138-191745160 TCTAGGTAAGGGATAAAGGTTGG - Intergenic
967862237 3:194160781-194160803 TTCAGGTCAAAGAAAAATGTGGG - Intergenic
969004115 4:4005554-4005576 GGAAGGTAAAGGAAAAAGGGGGG + Intergenic
969748745 4:9094586-9094608 TGTAGGTAAAGGAAAAAGGGGGG - Intergenic
969750689 4:9108295-9108317 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
969809792 4:9639160-9639182 GGTAGGTAAAGGAAAAGGGGAGG - Intergenic
970028735 4:11653709-11653731 GGTAGGTAAAGGAAAAAGCGGGG + Intergenic
970029528 4:11659001-11659023 TGTAGGTAAAGGAAAAAGGGGGG + Intergenic
970216475 4:13763954-13763976 TGAAGGCAGAAGGAAAAGGTGGG - Intergenic
970720411 4:18981623-18981645 ATTAGGTAAAATAAAAATGTTGG + Intergenic
970741168 4:19239345-19239367 TGAAGACAAAAGAAAAAGGCTGG + Intergenic
970803019 4:19998074-19998096 TGTTAGAAAAAGAAAAAGGTAGG + Intergenic
970848758 4:20575896-20575918 TGTAGGTAAGGGGAAAAGTTCGG + Intronic
971130055 4:23798085-23798107 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
971132417 4:23827395-23827417 TGCAGTTAAAAGGAAAAGTTGGG + Intronic
971362003 4:25946739-25946761 TTTAGGTAAAAGAAAAAAAAAGG + Intergenic
971661390 4:29421191-29421213 TGAAGTTCAAAGAAGAAGGTGGG + Intergenic
971713860 4:30150825-30150847 GGTAGGTAAAGGAGAAAGGGGGG - Intergenic
972346767 4:38198904-38198926 TGTGGGAAAATGAAAAATGTTGG + Intergenic
972785461 4:42322720-42322742 TGTAAGTAAATGAAAATGGAAGG - Intergenic
973338876 4:48984788-48984810 TGTATGCAAAAGAATAAAGTTGG - Intergenic
973632784 4:52835030-52835052 GGTAGGTAAAGGAAAAAGGAGGG - Intergenic
973765363 4:54157156-54157178 GGGAGGGAAAAGAAAAAGGGGGG + Intronic
973765382 4:54157201-54157223 GGGAGGGAAAAGAAAAAGGGGGG + Intronic
973774236 4:54230602-54230624 TGCAGGTAAGACAGAAAGGTGGG + Intronic
974134188 4:57793775-57793797 TGGAGGAAAAAAAAAAAGGCAGG - Intergenic
974507353 4:62793301-62793323 TGTAGGTAAAAGTAAAAATTAGG + Intergenic
974935702 4:68407344-68407366 GGTAGGTAAAGGAAAAAGGGAGG + Intergenic
975245580 4:72117075-72117097 TGAAGGAAAAAGAAAAGGGTGGG - Intronic
975474256 4:74804859-74804881 TGCAGGTAAAATAAAATTGTAGG + Intergenic
975695280 4:77006901-77006923 TGTAGATAAAATAAAGAGCTTGG - Intronic
975714583 4:77193462-77193484 TGTAGTTAAAAAAAAAAAGCGGG + Intronic
975994336 4:80296903-80296925 TGTAAGGAAATGAAAAAGGCAGG - Intronic
976203571 4:82602970-82602992 TGTCTGTAATAGCAAAAGGTTGG + Intergenic
976243453 4:82984143-82984165 TACAGGTAAAAGAAAAAAGGGGG - Exonic
976271467 4:83234733-83234755 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
976468225 4:85395961-85395983 TGTGGGGAAGAGAGAAAGGTAGG + Intergenic
976631474 4:87241663-87241685 AGAAGCTGAAAGAAAAAGGTAGG + Intergenic
976817775 4:89170134-89170156 TGTTTGTAAAAGCAAAAGATGGG + Intergenic
976884112 4:89964935-89964957 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
976884915 4:89970221-89970243 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
977233100 4:94475141-94475163 TTTAGGTAAAAAAAAAAAGGCGG - Intronic
977860190 4:101948583-101948605 TTTAGATAGAAGAAAAAGGGTGG - Intronic
978439070 4:108714687-108714709 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
978842999 4:113236644-113236666 TGTAGGTAAAGCAGAAAAGTGGG - Intronic
978965366 4:114734541-114734563 TGTAGAAAAAAGAAAAAGGAGGG + Intergenic
979146290 4:117252344-117252366 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
979147066 4:117257624-117257646 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
979170878 4:117600264-117600286 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
979513639 4:121582531-121582553 TGTGGCTCAGAGAAAAAGGTGGG - Intergenic
979580760 4:122356738-122356760 TTAAAGAAAAAGAAAAAGGTGGG + Exonic
979699282 4:123649423-123649445 TGTAGTTAAAAACCAAAGGTGGG + Intergenic
979947375 4:126850069-126850091 CTTAGGTAAAAGAAAAAGACTGG - Intergenic
980284635 4:130767646-130767668 GGTAGGTTAAGGAAAAAGGGGGG - Intergenic
980416456 4:132495525-132495547 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
980471934 4:133263701-133263723 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
980472685 4:133268648-133268670 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
980903571 4:138928071-138928093 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
980904399 4:138933380-138933402 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
981040704 4:140219031-140219053 GGTAGGAAAAGGAAAAAGGGGGG - Intergenic
982084282 4:151817973-151817995 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
982396207 4:154918471-154918493 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
982860662 4:160444863-160444885 AGAATGTGAAAGAAAAAGGTTGG + Intergenic
983023533 4:162709419-162709441 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983024332 4:162714583-162714605 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983345263 4:166520937-166520959 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983346060 4:166526267-166526289 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983447733 4:167876547-167876569 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983448521 4:167881859-167881881 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
983686758 4:170419418-170419440 TGTAAGAAAAAGAACAATGTTGG + Intergenic
983707376 4:170677882-170677904 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
984023827 4:174519717-174519739 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
985056893 4:186044165-186044187 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
985435403 4:189926128-189926150 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
985436214 4:189931695-189931717 GGTAGGTAAAGGCAAAAGGGGGG - Intergenic
986288053 5:6375221-6375243 TTTAGGGTACAGAAAAAGGTAGG - Intronic
986545370 5:8891359-8891381 TGAAGGCACAAGAAAAAGGGGGG + Intergenic
986554554 5:8998509-8998531 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
988008111 5:25445962-25445984 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
988233977 5:28515865-28515887 TGAAGGTATAAGAGAAAGATGGG + Intergenic
988250830 5:28755750-28755772 AGTAGATAAAAGAGAAAGTTAGG + Intergenic
989036997 5:37184805-37184827 TGTCGGTTGAAGAAAAAAGTAGG - Exonic
989119571 5:37990939-37990961 TGTAGGAAAAGGATAAAGGGCGG + Intergenic
989741002 5:44771894-44771916 TGTAGGAATAAGAAACAGATGGG - Intergenic
989966770 5:50474350-50474372 ACTGGGTAACAGAAAAAGGTTGG + Intergenic
990111113 5:52325972-52325994 GGAAGGTAAAAAAAAAATGTGGG + Intergenic
990791253 5:59482784-59482806 TGTAGGAAATAGAAAAATGATGG - Intronic
991059681 5:62360342-62360364 TAGAGTTAAAATAAAAAGGTGGG - Intronic
991177299 5:63704543-63704565 TGAAGTTAAAAGAAAAAGAAAGG + Intergenic
992309026 5:75475497-75475519 TGAGGGGAAAAGAAAATGGTAGG - Intronic
992583904 5:78212574-78212596 TGTAGGTAAAAGGGAATGGAGGG + Intronic
993092756 5:83447066-83447088 AGGAGATAAAAGAAAGAGGTTGG - Intergenic
993219487 5:85072641-85072663 TTTCTGTAAAATAAAAAGGTGGG - Intergenic
993567778 5:89496325-89496347 TGTAGGCAATAGGAAAAGTTGGG - Intergenic
993819914 5:92601477-92601499 TGTAGGTTAAAAAACAAAGTTGG - Intergenic
993885927 5:93414906-93414928 TGCAGTTAAAAAAAAAAGTTAGG + Intergenic
994295675 5:98085152-98085174 GGTAGGTAAAGGAAAAAGGATGG - Intergenic
994383950 5:99105760-99105782 TCAAAGTAAAAGAAAAAGGAAGG + Intergenic
994556661 5:101315478-101315500 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
994703697 5:103172159-103172181 TGTAAACAAAAGAAAAATGTTGG - Intronic
995178417 5:109206235-109206257 TGTAAGAAAAAGAAATAGGCTGG + Intergenic
995296547 5:110531170-110531192 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
995297112 5:110535355-110535377 GGTAGGTAAAGGAAAAAGGGGGG - Intronic
995679188 5:114697991-114698013 TGAAGGAAAAGGAAAAATGTGGG - Intergenic
995841284 5:116445682-116445704 TGTAGCTAAAGGAAAAAGTTAGG - Exonic
996143259 5:119941559-119941581 TGTAGATAGAATAAAAAGGCTGG - Intergenic
996588305 5:125116355-125116377 TCCAGGAAAAAGAAAAAGTTTGG - Intergenic
996725907 5:126673316-126673338 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
996962300 5:129265546-129265568 TGAAGATAAAAAAAAAAGGCTGG - Intergenic
997041370 5:130259140-130259162 TGTCAGTAAAAGAAAATGCTTGG - Intergenic
997482429 5:134196975-134196997 TGTAGGTAAAATAAAAATCAAGG - Exonic
997495690 5:134322580-134322602 TGTTCGTAGAAGAAAAAGATTGG + Intronic
998039501 5:138943555-138943577 TGTCTCAAAAAGAAAAAGGTGGG + Intergenic
998180397 5:139934712-139934734 TGTAGGTTAAAGTAAAAGCATGG + Intronic
998636752 5:143963795-143963817 TGAAGGTAAAAAAAGAAGGGAGG + Intergenic
998948577 5:147367547-147367569 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
999403302 5:151284212-151284234 TGGAGGGAAAAAAAAAAGTTGGG + Intronic
999681754 5:154066902-154066924 TGTTTGTAAAAGCAAAAGATTGG - Intronic
1000439078 5:161246039-161246061 GGTAGGTAAAAGGAAAAGGGGGG - Intergenic
1000518490 5:162270389-162270411 AGTAGGTGAAAGAGAAAGGAGGG - Intergenic
1000789458 5:165587379-165587401 TGCATATAAAAGTAAAAGGTAGG + Intergenic
1000885630 5:166744391-166744413 GGTAGGTAAAGGAAAGAGGGGGG + Intergenic
1003811136 6:9782760-9782782 AGTAAAGAAAAGAAAAAGGTGGG - Intronic
1003896063 6:10608919-10608941 TGTAGGTGAATGAAACACGTTGG + Intronic
1004001076 6:11597905-11597927 GGAAGGAAAAAGAAAAAGGAAGG - Intergenic
1004575696 6:16891483-16891505 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1004620597 6:17327147-17327169 TGAAGGAAAAAGAAAAAGGTGGG + Intergenic
1004679945 6:17883743-17883765 TCTAGGGAAAAGAAGAAGGAAGG + Intronic
1005224848 6:23630619-23630641 TGTAGGTAAAAAATAAAAGATGG - Intergenic
1005410691 6:25542553-25542575 AGTAGGGAACAGGAAAAGGTGGG - Intronic
1005533112 6:26728440-26728462 TGTGAATAAAAGCAAAAGGTTGG - Intergenic
1005537682 6:26773224-26773246 TGTGAATAAAAGCAAAAGGTTGG + Intergenic
1006301714 6:33196811-33196833 GGTAGGTAAAAGAATTAGGGAGG + Intronic
1006472351 6:34236080-34236102 TGTAAATAAAAATAAAAGGTGGG - Intergenic
1007460871 6:42017789-42017811 TGTAGGTAGAAGGCAAAGGCTGG + Intronic
1008106709 6:47446519-47446541 TGTAGGGCAGAGAATAAGGTGGG - Intergenic
1008476216 6:51938523-51938545 GGGAGGTAAAGGAAAAAGGGGGG - Intronic
1008477104 6:51944263-51944285 GGGAGGTAAAGGAAAAAGGGGGG - Intronic
1008489318 6:52069160-52069182 TGAAAGTAAAAGAAAAAAGGTGG - Intronic
1008650457 6:53555999-53556021 TGTAGGTGAAAGACAAATGATGG - Intronic
1009008556 6:57815634-57815656 TGTGAATAAAAGCAAAAGGTTGG + Intergenic
1009343282 6:62586218-62586240 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1009802805 6:68563290-68563312 TGTAGGTAGATGAAAGAGTTGGG + Intergenic
1010167948 6:72939496-72939518 TGTACGTTGAAGAAAAAGTTTGG - Intronic
1010414753 6:75600781-75600803 TGTAGGTAATAGGCAAATGTGGG - Intergenic
1010498244 6:76562535-76562557 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1010868507 6:81009567-81009589 AGTAGGTTAAAGTAAAAGGATGG - Intergenic
1011029545 6:82907060-82907082 TATGGGTAAAAGAAAAATGGAGG + Intronic
1011518970 6:88183386-88183408 TGTGGGAAAAAGTAAATGGTTGG + Intergenic
1011807518 6:91088855-91088877 TGTAGGTAAAATAACAAAGTGGG + Intergenic
1012233871 6:96790319-96790341 TGTAATTAAAGGAGAAAGGTGGG + Intergenic
1012270957 6:97210157-97210179 TTTAGGAAAAAGCAAAAGGTTGG - Intronic
1012316579 6:97788490-97788512 AATAGGTAAAAGAAAAAAATAGG - Intergenic
1012519157 6:100099781-100099803 TTTAGTTAAAAGTAGAAGGTTGG - Intergenic
1012664392 6:101949219-101949241 TGGAGGCAAAAGAAAAGTGTTGG - Intronic
1012693297 6:102345536-102345558 TATTTGTAAATGAAAAAGGTAGG - Intergenic
1012879692 6:104771739-104771761 TGTTTGGAAAAAAAAAAGGTAGG + Intronic
1013841404 6:114399137-114399159 TGGAGGCAAAAGAAAAAGAGAGG - Intergenic
1014197888 6:118579903-118579925 TGTAGTGACAAGAAGAAGGTGGG - Intronic
1014596976 6:123357145-123357167 TATAAGTCAAAGAAAAAAGTGGG - Intronic
1014614206 6:123582478-123582500 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
1014849032 6:126317621-126317643 AGTGAGTAAAAGAAAGAGGTTGG - Intergenic
1014869499 6:126574960-126574982 GGTAGGTAATAGAAAAAGTGAGG + Intergenic
1015048102 6:128803272-128803294 TGTAGGTAAAATAGAATGGTGGG - Intergenic
1015164867 6:130192548-130192570 GGAAGGTAAAGGAAAAAGGGGGG - Intronic
1015220232 6:130795979-130796001 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1015585836 6:134775529-134775551 TGTAAGAAAAAGAAAGAGGCTGG + Intergenic
1015833959 6:137399201-137399223 TGTAGGTCAAAGAAATGGGCAGG + Intergenic
1015917473 6:138232203-138232225 TTGGAGTAAAAGAAAAAGGTGGG + Intronic
1015928081 6:138329960-138329982 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
1016204202 6:141453062-141453084 GGTAGGTAAAGGAAAAAGGCGGG - Intergenic
1016205297 6:141460518-141460540 GGTAGGCAAAGGAAAAAGGGTGG - Intergenic
1016535293 6:145103325-145103347 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1016536086 6:145108598-145108620 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1016724184 6:147341758-147341780 GGCAGTTAAAAAAAAAAGGTAGG - Intronic
1017314628 6:153016228-153016250 TTCAGGTAAAATAAAAACGTTGG - Intronic
1018084044 6:160286753-160286775 GGTAGGTAAAGGAAAAAAGGGGG + Intergenic
1018084852 6:160292055-160292077 CGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1018225042 6:161620856-161620878 TGCTGATAAAAGAAAAAGATGGG - Intronic
1018759004 6:166873950-166873972 TATAGGTAAAGGAAATAGATGGG + Intronic
1018952456 6:168387945-168387967 TGAGGGTAAAAAAAAAAGTTTGG + Intergenic
1020324249 7:6962055-6962077 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1020490900 7:8782934-8782956 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1020798273 7:12702272-12702294 TGTAGGTAAAAGAAAGCTTTGGG - Intergenic
1021029354 7:15711031-15711053 TTTGGATAAAAGAAAAAGGATGG - Intergenic
1021102131 7:16596239-16596261 TACAGGTAAAAGAAAAATGAAGG - Intergenic
1022572294 7:31467001-31467023 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1022573043 7:31472119-31472141 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1022583090 7:31576686-31576708 TGTAGGTAAAAGAAAAAGGTAGG + Intronic
1022709564 7:32838110-32838132 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1023355068 7:39358278-39358300 TGAAGGAAAAAGAATAATGTGGG + Intronic
1023964554 7:44956205-44956227 TGTAGGTAGAAAAAAAAAGATGG - Intergenic
1024869431 7:53945154-53945176 TGTAAGAAAAAAAAAAAGGGTGG - Intergenic
1024909348 7:54427481-54427503 TGTAAGTAAAAGAAAGAGGCAGG - Intergenic
1025736886 7:64157476-64157498 TGTAGGCAATAGAAAAATATTGG + Intronic
1027109955 7:75429714-75429736 TGTAAATAAATGAAAGAGGTGGG + Intronic
1027376600 7:77556900-77556922 TGGAGGTAAAACAAAAATGTGGG + Intronic
1027471299 7:78577620-78577642 GGTAGGTAAAGGAAAAAGGGGGG + Intronic
1028110764 7:86938368-86938390 TCTAGGGAAAATAAAAATGTAGG - Intronic
1028125947 7:87113842-87113864 ACTATGTTAAAGAAAAAGGTAGG + Intergenic
1028341427 7:89724942-89724964 TCTAGGGAAAAGAAAAAGTGAGG - Intergenic
1030041183 7:105451555-105451577 TATAGGTGAAAGAAAATTGTAGG + Intronic
1030441191 7:109591963-109591985 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1030441990 7:109597331-109597353 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1030554822 7:111010688-111010710 TGAAGGTCAAAGAACAAGCTAGG + Intronic
1030622132 7:111801574-111801596 TCTAGGTCAAAAATAAAGGTAGG - Intronic
1030814152 7:114013621-114013643 TGGAGGGAAAAGGAAAAGGAAGG + Intronic
1031073593 7:117190491-117190513 TGTAGGAAAAAGAGAAAACTAGG - Intronic
1031354670 7:120776765-120776787 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1031422785 7:121569409-121569431 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1031479409 7:122260182-122260204 TGTTGGAAAAAGAAAAACCTAGG - Intergenic
1032356888 7:131219593-131219615 TGTAAGGAAAAAAAAAAAGTGGG + Intronic
1033276393 7:139974738-139974760 TATCTGTAAAAGAAAAAGGTTGG + Intronic
1033778874 7:144646081-144646103 AGGAGGGAAGAGAAAAAGGTAGG - Intronic
1036071256 8:5442041-5442063 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1036195997 8:6715426-6715448 TGGAGGAAAAAGAAGAGGGTGGG + Intronic
1036371815 8:8168910-8168932 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1036373885 8:8183696-8183718 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1036471790 8:9059054-9059076 GGTAGGTAAAGGAAAAAGCGGGG + Intronic
1036639120 8:10571317-10571339 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1036639993 8:10577165-10577187 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1036877018 8:12481945-12481967 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1036879087 8:12496734-12496756 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1037246965 8:16846042-16846064 TGTGGGTGAGAGGAAAAGGTTGG + Intergenic
1037457411 8:19077549-19077571 TCTAGGCAAACGAAAAAGGTGGG - Intronic
1038572139 8:28672011-28672033 TGTATGTAAAAGTTAAATGTTGG - Intronic
1038703167 8:29870273-29870295 TGTAGGAAAGAGAGAAAGGAAGG - Intergenic
1039345824 8:36704279-36704301 TATAGATAAAAGTAAAATGTGGG - Intergenic
1039591558 8:38754246-38754268 TGAAAGTAAAGGAAAAAGGCCGG - Intronic
1039689104 8:39843482-39843504 TGTAGGGGGAATAAAAAGGTAGG + Intergenic
1039872105 8:41555054-41555076 TGTAGCTGAAAGAGAAAGCTAGG - Intergenic
1041552120 8:59114725-59114747 TGTAAGAAAAAGGAAAAGATGGG - Intronic
1041868714 8:62608220-62608242 TTTAGGAAAAAGAAAAGTGTGGG - Intronic
1041950665 8:63497291-63497313 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1041951038 8:63502347-63502369 TGGAGGAAGAAGAAAAAGATTGG - Intergenic
1043037548 8:75217215-75217237 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1043149830 8:76701509-76701531 TTTAAGTAAAAGAAAAAGATCGG + Intronic
1043520731 8:81042633-81042655 TGTGTGTAAAAGAGAAAGGGGGG + Intronic
1043631370 8:82339326-82339348 ACTAGGTAAAAAAAAAAAGTGGG - Intergenic
1043670807 8:82881912-82881934 TTTAAATAAAAGAAAATGGTGGG + Intergenic
1043717386 8:83504844-83504866 GGTAGGTAAATGAAAAAAGGGGG + Intergenic
1043718244 8:83510663-83510685 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1044542591 8:93424475-93424497 AGCTGGTAAATGAAAAAGGTAGG + Intergenic
1045074394 8:98546981-98547003 AGTAGCAAAAAGAAAAGGGTGGG + Intronic
1045380999 8:101625773-101625795 GCTAAGTAAAAGAAAATGGTTGG + Intronic
1046291541 8:112168368-112168390 TTTAGGTAAGATAAAATGGTAGG - Intergenic
1046293791 8:112196111-112196133 GGTAGGTAAAGGAAAAAGGAGGG - Intergenic
1046294570 8:112201241-112201263 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1046760491 8:118015318-118015340 TATTGGTAAAAGAAAAGGCTTGG - Intronic
1046803574 8:118455455-118455477 TTTAGGTCAAAGAGGAAGGTGGG - Intronic
1047697728 8:127419497-127419519 TGTAAGTAAAAGGCAAAGGAGGG + Exonic
1047839723 8:128738148-128738170 TGTAGGTAAAAATAAAATTTTGG + Intergenic
1048036626 8:130683271-130683293 TGCAGAAATAAGAAAAAGGTTGG - Intergenic
1048097267 8:131310402-131310424 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1048098052 8:131315684-131315706 GGTAGGTAAAGGGAAAAGGGGGG - Intergenic
1048135145 8:131740991-131741013 GGTAGGTAAAGGAGAAAGGGGGG - Intergenic
1048135944 8:131746462-131746484 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1048668102 8:136687160-136687182 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1048728719 8:137413625-137413647 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1048763728 8:137824783-137824805 GGTAGTTAAAGGAAAAAGGGGGG + Intergenic
1049341967 8:142118029-142118051 TGTTGGTAGAAGACAGAGGTCGG + Intergenic
1049959119 9:721406-721428 TCAATGTAAAAGAAAAAGGGGGG + Intronic
1049993630 9:1013420-1013442 TTGAAGTAAAAGAAAGAGGTGGG + Intergenic
1050099414 9:2102591-2102613 TGTTGATAAAAGAAAAAAATGGG + Intronic
1050257576 9:3811043-3811065 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1050920985 9:11200232-11200254 TGTAGGGAGAAGAGAAAGGCTGG + Intergenic
1051449664 9:17181423-17181445 TGAAGGTAAAAGAAACAAATTGG - Intronic
1051952929 9:22658667-22658689 GATAGGTAAAGGAAAAAGGGGGG + Intergenic
1051953696 9:22663804-22663826 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1052192368 9:25675053-25675075 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1052367064 9:27624203-27624225 TGTGGGAAAAAGAAAAAGAGAGG - Intergenic
1052584051 9:30401752-30401774 TGTAGGAAGTAGAAAATGGTTGG - Intergenic
1052776189 9:32735351-32735373 TACAGGTAGAGGAAAAAGGTAGG + Intergenic
1054376193 9:64451396-64451418 TGTGGGTAAAAGGTAAGGGTAGG + Intergenic
1054806977 9:69404727-69404749 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1054807783 9:69410047-69410069 GGTAGGTAAAGGAGAAAGGAAGG + Intergenic
1055625263 9:78170008-78170030 TGTGTGTAAAAGAAAAACATTGG - Intergenic
1055881434 9:81009321-81009343 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1056617783 9:88183422-88183444 TCTAGGGAAAACAAAAAGTTGGG + Intergenic
1057161472 9:92891565-92891587 AGTGGGTAAAAGACAGAGGTTGG - Intergenic
1057642498 9:96838020-96838042 TGCACATAAAAGAAAAAGGCAGG - Intronic
1057812017 9:98265464-98265486 GGTAGGTAAAGGAAAAAAGGGGG + Intergenic
1057812884 9:98271142-98271164 GGTAGGTAAAGGAAAAAAGGGGG + Intergenic
1057882616 9:98804239-98804261 TGTATATAAAAGCAAAAAGTTGG - Intergenic
1058037505 9:100268918-100268940 TGTAGGTAAAGGAATAATTTGGG + Intronic
1058326680 9:103707156-103707178 TGTACTTAACATAAAAAGGTAGG + Intergenic
1058444944 9:105046556-105046578 AGTAGGTAGAAGAGAAAGGAAGG + Intergenic
1058605318 9:106715386-106715408 TCTTGGTAAAGGAAAAAGATGGG + Intergenic
1058665556 9:107312191-107312213 AGTAGGTAAAATTAAAAGTTGGG - Intronic
1058743546 9:107967828-107967850 TGGAGGAAAAAGCAAAGGGTGGG + Intergenic
1059284286 9:113159563-113159585 CGTAGGAAAAGGAAAAAGTTGGG - Intronic
1059398796 9:114055494-114055516 TGTGGGGAAAAGAAAAAGGCAGG - Exonic
1060273433 9:122164387-122164409 TGCAGGAAAGAGAAAAATGTAGG + Intronic
1060644028 9:125262487-125262509 TGAAGTTAAAAGAAAAGGGATGG - Intronic
1060737373 9:126074588-126074610 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1061642271 9:131968521-131968543 TGTCAGTAAAAGAAGAGGGTTGG - Intronic
1185684550 X:1917639-1917661 TGCAGGCAAAAGAAAAAGAAGGG + Intergenic
1186084840 X:5975960-5975982 TGGTGGCAAAAGGAAAAGGTGGG - Intronic
1186573805 X:10744180-10744202 TGTGGGTAAAATGAAAAGGAAGG + Intronic
1186738421 X:12491422-12491444 TGTAGTTAAATGAACAAAGTTGG - Intronic
1187086870 X:16050155-16050177 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1187192495 X:17048594-17048616 TGTAGGTAAGAGAAAATCATTGG - Intronic
1187891531 X:23940556-23940578 TGGAGGGAAAAGACAAAGGAAGG + Intergenic
1188287755 X:28349061-28349083 TGTAGGTATAATTAAAAGGCTGG - Intergenic
1188503577 X:30856095-30856117 TTTAGGTAAAAGAAAAATGAGGG - Intronic
1188531698 X:31148204-31148226 TGTAGGTGAAAGAAAAATACAGG - Intronic
1188688887 X:33104543-33104565 GGTAGATAAAGGAAAAAGGGGGG - Intronic
1190409706 X:50124336-50124358 TGTAGGTAAAGGAAATATTTAGG + Intergenic
1191729254 X:64315597-64315619 TGAAAGTAAAAAAAAAAGGATGG - Intronic
1192412255 X:70944512-70944534 TTTGGGTAAAAGAAAAAGCATGG - Intergenic
1192720569 X:73692762-73692784 TGCAGGCAAAAAAAAAATGTAGG + Intergenic
1193001334 X:76565882-76565904 TGTAAGAAAAAGAAAAAGGAGGG - Intergenic
1193042154 X:77015251-77015273 TGTACATAAATGAAAAAAGTGGG + Intergenic
1193760286 X:85457191-85457213 TATATGTAAAAGGAAAAAGTTGG + Intergenic
1193886382 X:86987324-86987346 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1194240285 X:91436449-91436471 TGAGGTTAAAAGAAAAAAGTCGG + Exonic
1194763325 X:97819839-97819861 TGTCAGTAAATGAAAAAGATAGG + Intergenic
1194873234 X:99158862-99158884 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1194912299 X:99661332-99661354 TGTATGTAAGAGAAAGAGGAAGG - Intergenic
1195608774 X:106839638-106839660 TGAAGATAAAAGATAAAAGTTGG + Intronic
1196224477 X:113149252-113149274 AGAAGGGAAAAGAAAAAGGGAGG + Intergenic
1196226644 X:113176273-113176295 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1196226663 X:113176339-113176361 GGTAGGTAAAGGAAAAAGGGGGG + Intergenic
1196299702 X:114040329-114040351 GGAAGGTAAAGGAAAAAGGGGGG - Intergenic
1196301200 X:114051466-114051488 GGTAGGTAAAGGAAAAAGGGGGG - Intergenic
1196373622 X:115006041-115006063 AATAGGACAAAGAAAAAGGTGGG - Intronic
1196670047 X:118356381-118356403 TGTAGGAAAAAAAAAAATCTGGG - Intronic
1197481567 X:126993436-126993458 TTTAGGTAAAGTAAAAAGTTTGG - Intergenic
1197609385 X:128622226-128622248 TCTAGGCAAAAGAAACAGATGGG - Intergenic
1197670082 X:129267114-129267136 GGTAAGTAAAAAAAAAAGGGGGG + Intergenic
1197799069 X:130329974-130329996 TGGAGGAAAAAAAAAAAGGCAGG - Intergenic
1198011924 X:132565405-132565427 TGTATAGAAAAGAAATAGGTGGG + Intergenic
1198598945 X:138264499-138264521 GGTAGGTAAAGGAAGAAGGGGGG + Intergenic
1198599734 X:138269774-138269796 GGTAGGTAAAGGAAGAAGGGGGG + Intergenic
1198601196 X:138285880-138285902 TGTGAGTATAAGAAAAAGCTAGG - Intergenic
1198630795 X:138636167-138636189 TTTACCTAAAAGTAAAAGGTAGG - Intronic
1199265354 X:145821223-145821245 TGTAGGTGAGAGAAAGAGGGAGG + Exonic
1199439007 X:147847169-147847191 TTAAGGTAAAAGAAAAATGGTGG + Intergenic
1200837390 Y:7746208-7746230 TTTAGGTAAAAGAAAAATAGAGG + Intergenic
1202017225 Y:20422826-20422848 TGCAGGTAACAGAAAAGGGGTGG + Intergenic
1202201909 Y:22361384-22361406 TGTAGGAAGAACAAAAAGCTAGG - Intronic