ID: 1022584734

View in Genome Browser
Species Human (GRCh38)
Location 7:31596765-31596787
Sequence TTATATTGGAATATAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022584732_1022584734 19 Left 1022584732 7:31596723-31596745 CCTCAAAATATAAAAGGAACAGA 0: 1
1: 0
2: 7
3: 72
4: 928
Right 1022584734 7:31596765-31596787 TTATATTGGAATATAGAGAATGG 0: 1
1: 0
2: 1
3: 25
4: 422
1022584731_1022584734 20 Left 1022584731 7:31596722-31596744 CCCTCAAAATATAAAAGGAACAG 0: 1
1: 0
2: 4
3: 43
4: 663
Right 1022584734 7:31596765-31596787 TTATATTGGAATATAGAGAATGG 0: 1
1: 0
2: 1
3: 25
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022584734 Original CRISPR TTATATTGGAATATAGAGAA TGG Intronic
903012547 1:20341936-20341958 TTATTTTGGAGTAAGGAGAAAGG - Intronic
905360977 1:37420108-37420130 ATATATTGGAATATGGATTAAGG - Intergenic
905865940 1:41376826-41376848 TTATATTCTAATATAAAGATAGG + Intronic
907061208 1:51427540-51427562 TGCTATTGGAACACAGAGAATGG + Intronic
908390036 1:63675792-63675814 TCATATTGGAAAAAAGAGACAGG - Intergenic
909494161 1:76259691-76259713 TTATATACTAATAGAGAGAAGGG - Intronic
909597909 1:77427622-77427644 TAGTGTTGGTATATAGAGAATGG - Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910483686 1:87686377-87686399 TCTCATTGGAATATAAAGAAGGG + Intergenic
910534595 1:88282770-88282792 TCATATTGGAAAATATAAAAAGG - Intergenic
910944823 1:92578829-92578851 TTATAATGATATAAAGAGAATGG - Intronic
911463478 1:98220696-98220718 TTAAATTTGACTATATAGAATGG - Intergenic
912614296 1:111082126-111082148 TTATTTTTGTATATGGAGAAAGG + Intergenic
913378537 1:118184093-118184115 TTATAGTGGAAAATAAAGACAGG + Intronic
915933251 1:160073596-160073618 TGATAGTGGAATAGAGAGGAAGG - Intergenic
916305998 1:163333652-163333674 ATATATTTGAAGATAGACAATGG - Intronic
916432135 1:164740830-164740852 TTCTATGGGAAGATAGAAAAGGG + Intronic
918072686 1:181144697-181144719 TTATATTAGAAAATAAACAAAGG + Intergenic
918847055 1:189629468-189629490 TTATATTTAAATGAAGAGAAAGG - Intergenic
918917526 1:190663836-190663858 TTATCTTGAAATTTGGAGAAGGG - Intergenic
919035222 1:192298778-192298800 TTATCTTGAAATATTGAGAAAGG + Intergenic
919301257 1:195769584-195769606 TAGTATTGGAATTTAGAGGAGGG - Intergenic
919329272 1:196148287-196148309 TTATATTTGAGCAAAGAGAAAGG - Intergenic
919418185 1:197337337-197337359 ATATATAGTAATATAAAGAACGG + Intronic
921060579 1:211580646-211580668 TTTTGCTGGAATATAAAGAATGG + Intergenic
921412130 1:214846794-214846816 TTCTATGGCAATATTGAGAAGGG - Intergenic
921716379 1:218421240-218421262 TTATAATGAAATAAATAGAAAGG + Intronic
922145228 1:222937388-222937410 ATATATTGAAGTATAGAGAGGGG - Intronic
923457588 1:234177796-234177818 TTATATTGGAACATATGGATTGG + Intronic
923706647 1:236349608-236349630 TTATCCTGGAATCAAGAGAAAGG + Intronic
924331246 1:242942817-242942839 TTATATTATAATATAAACAATGG + Intergenic
1063209932 10:3870809-3870831 TTATATTGGAATACTGTGTAAGG + Intergenic
1063474419 10:6316048-6316070 TTATAGTGGAATACAGAAAAAGG + Intergenic
1063794572 10:9498199-9498221 ATATACAGGAATGTAGAGAAGGG + Intergenic
1064056772 10:12104477-12104499 TTATTTTGGAATAAAAAGGAAGG - Intronic
1064310419 10:14207476-14207498 TTATATTGTACTATAGACCAGGG - Intronic
1064656938 10:17565772-17565794 TTATATTGAAAGAGAAAGAATGG - Intergenic
1065331729 10:24608393-24608415 TTATTTTGGAAGCTAGAGACTGG - Intronic
1065900541 10:30203586-30203608 TAATATGGGAATATACTGAAAGG - Intergenic
1066771764 10:38851987-38852009 TTTTATGGAAATATATAGAATGG + Intergenic
1068086261 10:52376587-52376609 TTATAATGCAAAATAGAAAATGG - Intergenic
1069459986 10:68585637-68585659 TTGTATTGGATTTCAGAGAAAGG + Intronic
1070066517 10:73040230-73040252 TTTTATTGGATTTTTGAGAAAGG - Intronic
1070108360 10:73458624-73458646 GTATATTTTAATATAGAGACAGG - Intronic
1070241936 10:74690580-74690602 TTATTTTGCAATATAGTCAAAGG - Intronic
1070460950 10:76669619-76669641 TTATATTTCCATATAGAGAGAGG + Intergenic
1071937598 10:90548607-90548629 TTATACAGGAATGTAGAAAAAGG - Intergenic
1073682810 10:105722769-105722791 TTATTTTGGAGTATACAGTAAGG - Intergenic
1073732467 10:106306182-106306204 CCATATTGGAATCTGGAGAAAGG + Intergenic
1073794452 10:106972734-106972756 TACTATGGGAATAAAGAGAAGGG + Intronic
1074074850 10:110113570-110113592 TTATTTTAGAAAATAGAGACAGG - Intronic
1074684985 10:115953028-115953050 TTGTATTGGTATATAAAGGAAGG + Intergenic
1075190956 10:120308240-120308262 TAATATTCCAATATAGAAAATGG - Intergenic
1077344989 11:2043190-2043212 TAAGATTGGAGTATGGAGAATGG - Intergenic
1077345512 11:2048489-2048511 TAAGAATGGAGTATAGAGAAAGG - Intergenic
1077346987 11:2065105-2065127 ATATAATGGAGTATGGAGAATGG - Intergenic
1077742598 11:4863302-4863324 TTTCATTGGGAGATAGAGAAAGG - Intronic
1078285123 11:9945421-9945443 TTATTTTTGTATATAGTGAAAGG - Intronic
1078775982 11:14393960-14393982 TTATATTAAGATATAGAAAAGGG - Intergenic
1080939438 11:36898771-36898793 TTATTTTGGAATAACCAGAAAGG + Intergenic
1081226664 11:40532447-40532469 TTATATTAGAATATAGCCTATGG + Intronic
1081236228 11:40650315-40650337 TTATTTTGGAAAAAAGAAAAAGG - Intronic
1081259464 11:40941825-40941847 TTATAATTTAATTTAGAGAAGGG + Intronic
1081822811 11:46016589-46016611 TGCTCTTTGAATATAGAGAAGGG - Intronic
1081947390 11:47009486-47009508 TTATATTGAAATAAGTAGAAAGG + Intronic
1082035727 11:47643896-47643918 TTATATTGAAATACAGATATTGG + Intergenic
1082881465 11:58042113-58042135 TAATATTGTTATTTAGAGAAGGG - Intronic
1083045242 11:59728672-59728694 ATACATTGGAATATGGAGGAAGG - Intronic
1083101584 11:60312459-60312481 GTAAATTGGATTATAGAGCATGG + Intergenic
1085204110 11:74720074-74720096 TGAGATTGAAATATGGAGAAGGG + Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1086486622 11:87310212-87310234 TTTTATAGGAACATACAGAATGG - Intronic
1087368853 11:97255275-97255297 TTTTATAGAAATGTAGAGAATGG + Intergenic
1087472344 11:98592077-98592099 TTAAATTGGAATGTCGAAAATGG + Intergenic
1088525177 11:110745375-110745397 TTATATTTGGATTTAGAGACTGG + Intergenic
1089250949 11:117161035-117161057 TTATCTTTGAATACAGAAAAAGG + Intronic
1091243781 11:134073953-134073975 TTATTCTGGAAGAAAGAGAATGG + Intronic
1202827920 11_KI270721v1_random:98063-98085 TAAGATTGGAGTATGGAGAATGG - Intergenic
1091780703 12:3213007-3213029 TGATATTGGAAGCCAGAGAAAGG + Intronic
1092957113 12:13561116-13561138 TAACATTGGAAAATTGAGAAGGG - Exonic
1093862580 12:24185119-24185141 TTATAATGGGATATAGATATGGG + Intergenic
1093901658 12:24642315-24642337 TTATATTGAAATATCGAATATGG + Intergenic
1094172560 12:27509102-27509124 TTATATTGGATTAAAGAATAAGG + Intergenic
1095586320 12:43853586-43853608 TTTTATTGTAAGATATAGAAAGG + Intronic
1096053683 12:48633049-48633071 ATATATTTTAATAAAGAGAATGG - Intergenic
1096326289 12:50665134-50665156 ATATATAGAAATATAGAGCAGGG - Intronic
1097382259 12:58909088-58909110 TTAAATGGGGATGTAGAGAAAGG - Intronic
1098068717 12:66648398-66648420 TTTTGTTGGAACTTAGAGAAGGG - Intronic
1098416467 12:70240772-70240794 TTTGGTTGGTATATAGAGAATGG + Intergenic
1098657255 12:73048023-73048045 TTTTACTGGAATATAGAAACTGG + Intergenic
1099091351 12:78313717-78313739 TTATATTGTGATATAGAACATGG - Intergenic
1099922341 12:88974561-88974583 TTAAATTGGAAGATATAGTAGGG - Intergenic
1100183125 12:92107071-92107093 TTATATTCTAACATAGATAAGGG + Intronic
1101342067 12:103851126-103851148 TTAAAATGAAATAAAGAGAAGGG + Intergenic
1103425249 12:120828359-120828381 TTATACTGGAAAATAAAAAAAGG + Intronic
1103660506 12:122511683-122511705 TTTTATTAGATTACAGAGAATGG - Intronic
1104418890 12:128618784-128618806 TTATAAAGGAAAATAGATAATGG - Intronic
1104800197 12:131549719-131549741 ATATTTTGTAATATAGAGACAGG + Intergenic
1105383166 13:19905964-19905986 TTATATTAAAAAATAGAGATGGG - Intergenic
1106978343 13:35248764-35248786 TAATTTTGGTATATGGAGAAAGG - Intronic
1107215132 13:37908135-37908157 TTATCTTGGATTATTGAGATGGG + Intergenic
1108826442 13:54417617-54417639 ATGTATTGGAATATTAAGAATGG - Intergenic
1108992184 13:56674086-56674108 TTATATTAAAATATAGAGGCAGG + Intergenic
1109382540 13:61583521-61583543 TTATATTAGAAAAAAAAGAAAGG + Intergenic
1109402326 13:61850493-61850515 TTATATTTAAATATAAAGTATGG + Intergenic
1110269795 13:73576382-73576404 TTATCTTGGAATAAATATAAAGG + Intergenic
1110887050 13:80653447-80653469 TGAAATTGGAAAAGAGAGAATGG + Intergenic
1111133738 13:84010852-84010874 ATATATTTGAATATTGAGATAGG + Intergenic
1111278044 13:85978092-85978114 TGATATAAGAATAAAGAGAAAGG + Intergenic
1111281209 13:86027738-86027760 TAATATTAGAATATCGAGAGAGG - Intergenic
1111976381 13:94970494-94970516 TGACATTGGGAAATAGAGAATGG + Intergenic
1112006142 13:95255382-95255404 CTATTTTGGACTACAGAGAATGG - Intronic
1112356881 13:98681028-98681050 TCATCATGGAATTTAGAGAAAGG + Intergenic
1112920865 13:104611139-104611161 TAGAACTGGAATATAGAGAATGG + Intergenic
1113609612 13:111634512-111634534 TGAAATTAGAATATACAGAAAGG + Intronic
1113702681 13:112398974-112398996 TTATATTGTAAAATAAAGCATGG + Intronic
1113806723 13:113114294-113114316 TTGTAATGGAAAGTAGAGAAGGG - Intronic
1114136617 14:19859103-19859125 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1114826386 14:26085978-26086000 TTATACAGGAATGAAGAGAAAGG + Intergenic
1115215229 14:31007527-31007549 CTATATTGGAATATGATGAAAGG + Intronic
1116333400 14:43624011-43624033 TAAAATTGGAATAAAGAGAAAGG + Intergenic
1118310380 14:64688019-64688041 TAATATTTGAATATATAAAATGG + Intergenic
1118386789 14:65262320-65262342 TAATTTTGTAATATACAGAATGG + Intergenic
1120117033 14:80631510-80631532 TTATCTTTGAATATAAAGAATGG - Intronic
1120365811 14:83567228-83567250 TTATATTGGAATATCAACATTGG - Intergenic
1120708549 14:87770136-87770158 TTATTTAGAAATATAGAGGAAGG + Intergenic
1120944912 14:89985444-89985466 TTATATTGTAATAAAGATAGAGG + Intronic
1123440069 15:20284102-20284124 TAATATTGGTAGAGAGAGAAAGG - Intergenic
1123915725 15:25024487-25024509 TTATATGAGAATACAGGGAAAGG + Intergenic
1126464171 15:48945525-48945547 TTATACTGGAATAAAAAGAAAGG + Intronic
1126964953 15:54041147-54041169 TTATATTTTAAAATATAGAAAGG - Intronic
1127124877 15:55802186-55802208 TTATTTTGGAGAAGAGAGAAGGG + Intergenic
1127391812 15:58511712-58511734 TTAATCTGGGATATAGAGAAAGG + Intronic
1128373522 15:67058822-67058844 TTATCTTGGAAAATAGGAAACGG + Intergenic
1128375154 15:67068915-67068937 TTAGTTTGGAAAGTAGAGAAAGG + Intronic
1128407879 15:67362369-67362391 TTATATTGGTGTAGAAAGAATGG + Intronic
1128813791 15:70590812-70590834 TTATTTTGGAAGTTAGAAAAGGG - Intergenic
1128906705 15:71473908-71473930 TTAAATTGGAATTTAGGGCAGGG + Intronic
1129528000 15:76234785-76234807 TTATTCTGAAATATAGAGAAGGG + Intronic
1129551705 15:76457680-76457702 TATTATTATAATATAGAGAATGG - Intronic
1131351409 15:91703864-91703886 ATGTATAGAAATATAGAGAAAGG - Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132504474 16:300498-300520 TTATATTAAAATATAGAGGTAGG - Intronic
1133846990 16:9464283-9464305 TGATATTGGAGGATGGAGAAGGG + Intergenic
1135832316 16:25786566-25786588 TTTCATTGGGATATAGTGAAAGG - Intronic
1135924470 16:26680487-26680509 TTATATGAGAATACAGAAAAAGG + Intergenic
1138834839 16:60421707-60421729 TCATATTGTAATATAGAAAAAGG + Intergenic
1139032274 16:62899493-62899515 TTTTCTTAGAATATACAGAAAGG + Intergenic
1139037234 16:62961870-62961892 ATGTATTGGTTTATAGAGAAGGG - Intergenic
1139236193 16:65342089-65342111 TTATCTTTGAATATTTAGAATGG + Intergenic
1139276804 16:65735484-65735506 AAAAATTGGAATATACAGAAAGG - Intergenic
1141113120 16:81286676-81286698 TTATTTTTTAATATAGAGACAGG - Intronic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1144490944 17:15708477-15708499 TTATATTGTAAGAAAAAGAAAGG - Intronic
1145404544 17:22574592-22574614 TTATTTTAGACAATAGAGAAAGG - Intergenic
1146235471 17:31156840-31156862 TTAAATAGGAATTTAGAGAGAGG - Intronic
1146831669 17:36075060-36075082 TTATACAGGAAAATACAGAATGG - Intergenic
1148970542 17:51477073-51477095 TTAGATGGGAATAAAGGGAAAGG - Intergenic
1149257787 17:54846692-54846714 CTATATTTGTATATAGAAAATGG - Intergenic
1149356164 17:55841860-55841882 TTATATGGGAGTATAGGAAAAGG - Intronic
1150891563 17:69156621-69156643 TTATTTTTGAAAATAGAGACAGG - Intronic
1153143136 18:1997937-1997959 TTACAGTGAAATAAAGAGAATGG + Intergenic
1153200264 18:2640476-2640498 TTGTACTGGGTTATAGAGAAGGG + Intergenic
1153275226 18:3361099-3361121 TAATTTTGGAAAATGGAGAAGGG - Intergenic
1154460888 18:14584115-14584137 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1155681931 18:28498349-28498371 TAATAGTGCAATATAAAGAAAGG + Intergenic
1156807626 18:41205097-41205119 GTAGATTGCAATAAAGAGAATGG + Intergenic
1157950456 18:52030853-52030875 TACTATGGGAATATAGGGAAAGG + Intergenic
1158610191 18:58932806-58932828 TTATATTAAAATATATAGATTGG - Intronic
1159367077 18:67481854-67481876 TTATATTTTAATAGAAAGAATGG - Intergenic
1159547726 18:69861044-69861066 TTATATTGGTTTGTATAGAATGG - Exonic
1159781432 18:72665071-72665093 TTATATTTTAAAATATAGAAGGG + Intergenic
1159812318 18:73030539-73030561 TGATATTGGAATAAAGATAGTGG + Intergenic
1165292321 19:34897058-34897080 TTATTTTTTAATATAGAGATGGG + Intergenic
1166743867 19:45130603-45130625 TTATTTTGGAATGAACAGAAAGG - Intronic
1166990496 19:46689909-46689931 TTCTATTTAAATATAGAGATGGG + Intronic
925074491 2:1003536-1003558 TTGTATTGGAGTCTAGAGAGAGG + Intronic
925075806 2:1014729-1014751 TTATATGGGCAGAGAGAGAAGGG + Intronic
925804837 2:7638037-7638059 TAATTTTGGAAGATAGTGAAAGG - Intergenic
927001938 2:18804973-18804995 ATATAATGGAATATGGAGATGGG + Intergenic
927583566 2:24278261-24278283 TGATAGAGGAATATACAGAATGG - Intronic
928369353 2:30729852-30729874 GTATATTGGCACATAGAGAATGG + Intronic
928558924 2:32457848-32457870 TGATATTGGAATCTGGATAATGG - Intronic
928739457 2:34332877-34332899 TTATATTGAAAAATAGAGTAGGG + Intergenic
928773023 2:34724632-34724654 TTGGATTGGAGTATACAGAATGG + Intergenic
928783413 2:34852716-34852738 ATATATTGGATTATATATAATGG - Intergenic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
929432577 2:41900346-41900368 TTATATTACAATACTGAGAAAGG - Intergenic
929892159 2:45927286-45927308 TGGTATTGGAACCTAGAGAAGGG + Intronic
930399074 2:50860380-50860402 TTATATATGATTTTAGAGAAGGG + Intronic
930450993 2:51537941-51537963 TTATATTGGATTCTAAAGAATGG + Intergenic
930706976 2:54514491-54514513 TTATCTCTGAATATTGAGAATGG + Intronic
931356837 2:61544611-61544633 TTATATTCGAATAAAAAGGAAGG - Intergenic
932046729 2:68357503-68357525 TAACATTGAAATATAGAGATCGG - Intergenic
933217983 2:79652467-79652489 CTGGATTTGAATATAGAGAAAGG - Intronic
933314868 2:80703967-80703989 TTATCTTGGAATATAAAGCATGG - Intergenic
934122359 2:88852681-88852703 TTATTTTGGAGAAAAGAGAAAGG - Intergenic
934549493 2:95247332-95247354 TAATATTTGTATATAGTGAAAGG - Intronic
936604389 2:113934948-113934970 TTAAATGGGTATATAGAGAAAGG + Intronic
937999848 2:127724166-127724188 TTATATTGCAATAAAGAGATTGG - Intronic
938323068 2:130378150-130378172 TTATTTTAGAATATACAAAATGG + Intergenic
939211353 2:139179156-139179178 ATATATTGGAAAAGATAGAAGGG + Intergenic
939358370 2:141134277-141134299 CTATAATGGAATGTGGAGAATGG - Intronic
939491378 2:142881337-142881359 TTGTCTAGGAATATAAAGAATGG + Intronic
939639298 2:144619669-144619691 TTATTTTTGAATAAATAGAAGGG + Intergenic
939666936 2:144964152-144964174 TTATATTGGAATCTAGGGGCAGG - Intergenic
940275759 2:151938977-151938999 TTATATCTGCAGATAGAGAAAGG - Intronic
940637736 2:156319392-156319414 TTAAATTGGGATTTCGAGAAGGG - Intergenic
941106609 2:161361477-161361499 TATTATTGGAAAATAGAAAATGG + Intronic
941469503 2:165866945-165866967 CTATATTGTAAAAGAGAGAAAGG + Intronic
942037083 2:172020457-172020479 TTATACTGAAATGTAGAGTAAGG + Intronic
942124145 2:172806265-172806287 TTATATTGCAAGATAGAAAATGG + Intronic
942479781 2:176372408-176372430 TTGTAGGGGAATATAGACAAAGG - Intergenic
944886519 2:204068236-204068258 TTATATTGGAACATAAAAAGTGG - Intergenic
945904785 2:215579357-215579379 TTGTATTTGATTACAGAGAAAGG + Intergenic
947217605 2:227763611-227763633 TTATATTGGAAGATCAAGGAAGG + Intergenic
947372651 2:229464457-229464479 TTAATTTGGAATACATAGAAGGG + Intronic
947419591 2:229930174-229930196 TTATTTTTAAAAATAGAGAAGGG - Intronic
948246599 2:236491569-236491591 TTGTGTTGGAAAATGGAGAAGGG - Intronic
1170187961 20:13612948-13612970 TTATTTTAGGATATAGAGGATGG + Intronic
1172241824 20:33418118-33418140 CTATATAGGGATAGAGAGAAGGG - Intronic
1173050778 20:39559213-39559235 TACTATTGGGATATAGAGAAAGG - Intergenic
1173086731 20:39926712-39926734 ATATATTGGAAGATATAAAAGGG + Intergenic
1173334907 20:42104619-42104641 TGATATTGTAGTAGAGAGAACGG + Exonic
1176344555 21:5730187-5730209 TGATATTTGAATATGGAAAATGG + Intergenic
1176351369 21:5850771-5850793 TGATATTTGAATATGGAAAATGG + Intergenic
1176500272 21:7594268-7594290 TGATATTTGAATATGGAAAATGG - Intergenic
1176538876 21:8128257-8128279 TGATATTTGAATATGGAAAATGG + Intergenic
1176557827 21:8311302-8311324 TGATATTTGAATATGGAAAATGG + Intergenic
1177216625 21:18138188-18138210 TTACAGTGGAAAATAGAGTAAGG - Intronic
1177642906 21:23866807-23866829 TTATATTATAATATAGATGAGGG - Intergenic
1178985751 21:37301425-37301447 TTGTATTTTAATATAGAGACGGG + Intergenic
1180978458 22:19865747-19865769 TTATTTAGGAAAATAGAGAAGGG - Intergenic
1182213363 22:28695245-28695267 TAATATTGGTAGAGAGAGAAAGG + Intronic
1182408970 22:30165444-30165466 TTTTATTGGGATTTTGAGAAAGG + Intronic
1184354823 22:43972367-43972389 TTATATTGGAACTTAGAGTTGGG + Intronic
1203243825 22_KI270733v1_random:44612-44634 TGATATTTGAATATGGAAAATGG + Intergenic
949548923 3:5096332-5096354 TGATAATGGAATAAAGAGACAGG - Intergenic
949994574 3:9606460-9606482 TTATTTTTAAATATAGAGATGGG + Intergenic
950331022 3:12156279-12156301 TTATTTTGGAGTTCAGAGAACGG - Intronic
950921866 3:16703068-16703090 TTATTTTTGTATATAGAAAAAGG - Intergenic
951635234 3:24767016-24767038 ATAAATTGGAATATAGAGCCTGG + Intergenic
951806586 3:26651136-26651158 TCATTTTGTCATATAGAGAATGG + Intronic
953896208 3:46804814-46804836 TTATATGGGAATATAGGTAGGGG - Intronic
955259635 3:57373632-57373654 TTAAATTGCAATTTAGAAAATGG - Intronic
955266149 3:57447176-57447198 TTTTATGGGAATGTAGAAAATGG - Intronic
957206554 3:77205803-77205825 AAATATTGAAATATATAGAAAGG + Intronic
957390890 3:79567244-79567266 GTCTATTGGAGTGTAGAGAATGG + Intronic
957479116 3:80769049-80769071 TTATATTTGAAATTAGAGATTGG + Intergenic
957705576 3:83776745-83776767 TTAAATTGAAATACAGAAAAGGG + Intergenic
957828649 3:85486564-85486586 TGATATTACAAAATAGAGAATGG - Intronic
957929436 3:86859874-86859896 ATATATTGGAATATATATATTGG - Intergenic
958719655 3:97828060-97828082 TTATATTTAAATACAAAGAAAGG + Intronic
959515584 3:107263226-107263248 TTGTATTGGATTATTAAGAAAGG - Intergenic
959573129 3:107906966-107906988 TTATATTGAAAGAGAGAGATAGG + Intergenic
959660660 3:108864359-108864381 TGATTTTGGAATATATAGTAAGG - Intergenic
960023188 3:112978546-112978568 GTAAATTGGAAAATAGAAAATGG - Intergenic
960627559 3:119695863-119695885 TTATTTTGGAATAAAGAAATAGG - Intergenic
960644561 3:119864890-119864912 TTATTTCGGAACATAAAGAAAGG + Intronic
960834314 3:121889296-121889318 AAATATTGCAATATAGAGGATGG + Intergenic
961207109 3:125093315-125093337 TGATATTGGAGAACAGAGAAGGG - Intronic
961709468 3:128816456-128816478 CTAAATAGGAATATAGAAAAAGG - Intergenic
962339752 3:134571940-134571962 TTCTATTGGAATAAAGCTAAAGG + Intronic
962592063 3:136900669-136900691 TTTTATTGGTATATAGAAACAGG + Intronic
962659622 3:137588140-137588162 TTAAATTTGAATATAGACTATGG + Intergenic
963124540 3:141802941-141802963 TTATAATAGAATATGCAGAAGGG - Intronic
963279486 3:143368419-143368441 TCATATTTGAATATTGACAAAGG - Intronic
963733767 3:148995919-148995941 TTATATTGGATTCTACAAAATGG + Intronic
963794294 3:149616345-149616367 TTACATGGGATTACAGAGAAGGG - Intronic
963807101 3:149734108-149734130 CTATAGTGGAATAGAGAAAAGGG - Intronic
963857877 3:150274470-150274492 CTATTTTGGAATACAGAGAAAGG + Intergenic
963944689 3:151132671-151132693 ACATATAAGAATATAGAGAAAGG - Intronic
964502680 3:157365978-157366000 TTATAGGGTAAGATAGAGAATGG + Intronic
964670393 3:159219049-159219071 TTATATTGGATTATCCAGAGGGG - Intronic
964732402 3:159881583-159881605 TTATATTGCCAGATACAGAAAGG + Intronic
965167527 3:165214774-165214796 TTCTATGGAAATACAGAGAAGGG - Intergenic
966483099 3:180433572-180433594 TATTATGGGAGTATAGAGAACGG - Intergenic
966902220 3:184494804-184494826 TTATAGTGGAAAAAAGGGAAAGG + Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
967862474 3:194162305-194162327 TTTTATTTGATTATAGAGATGGG - Intergenic
968256871 3:197282536-197282558 TTATAATAGAATAAAGAGAATGG - Intronic
968618002 4:1590206-1590228 TTGTATTGCATTATAGTGAAAGG + Intergenic
970227291 4:13872862-13872884 CCATAATGGAATATGGAGAAAGG + Intergenic
970458767 4:16252004-16252026 TTATGTTGGAATATGTAGGATGG + Intergenic
970831155 4:20341162-20341184 GTATATTGAAATAAAGAGCAAGG + Intronic
970843757 4:20510863-20510885 TTATATGGGAAAGTAGACAATGG + Intronic
971527256 4:27636252-27636274 GTATATTGGAAAACAGACAATGG + Intergenic
972650029 4:41007938-41007960 TTCTTTGGGAATACAGAGAAAGG + Intronic
973206525 4:47566443-47566465 TTATATTAGAATCTACAAAAAGG + Intronic
974217005 4:58861135-58861157 TTAGGTTGGAATATAGTGACAGG - Intergenic
974787164 4:66633403-66633425 TTATAGTTGAATATAGTGTAAGG + Intergenic
975090574 4:70397872-70397894 TTTTATTGGAGTTAAGAGAAAGG - Exonic
975211084 4:71700916-71700938 ATAAATTGGAATATAATGAAAGG - Intergenic
975481390 4:74884432-74884454 TTCTAATGGAAGAGAGAGAAGGG - Intergenic
976435621 4:85014405-85014427 TTAAAATGGATAATAGAGAAAGG + Intergenic
976467993 4:85393253-85393275 TTTTATAAGAATATAGGGAATGG + Intergenic
976628895 4:87217659-87217681 TTTTTTTGGAATATAGAGAAAGG + Intronic
977140113 4:93360295-93360317 TTATTTCGCAAGATAGAGAATGG - Intronic
977268381 4:94883493-94883515 ATATTTTGTAAAATAGAGAAAGG - Intronic
977401003 4:96532339-96532361 CTGTATTGAAATATAGAGAATGG + Intergenic
977685444 4:99842305-99842327 TTATATTGTAATAAATAAAATGG - Intronic
978085282 4:104644655-104644677 TTATATGGAAAAATAGAGTATGG - Intergenic
978612075 4:110553242-110553264 TTGTATTGGAATTTAGCTAAGGG + Intronic
978806202 4:112803312-112803334 TTATATTGGATTATCCAGATGGG + Intergenic
978817363 4:112923767-112923789 AGATATTGGAATAGAGAGGAAGG + Intronic
980504326 4:133695507-133695529 TTATATTTGTATATACTGAAAGG - Intergenic
980701706 4:136441404-136441426 TTATTTTGGAATTTAAAAAATGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981287744 4:143039728-143039750 TGATATTGGAAGATAGAAGATGG + Intergenic
981336301 4:143572644-143572666 TTATAGAGGAATATATAGAGGGG + Intergenic
982381672 4:154755566-154755588 TTCTGTAGCAATATAGAGAATGG + Intergenic
982552914 4:156825202-156825224 GTATCTAGGAATATAGAGATGGG + Intronic
982643009 4:157986188-157986210 TTAAATTAAAATATGGAGAAGGG + Intergenic
982656908 4:158161643-158161665 TTAAAGTGGAATATTGAGACAGG - Intronic
983429110 4:167625196-167625218 TTCTATTGAAATATAAGGAAAGG - Intergenic
983724105 4:170897586-170897608 TTATATTTTTATATACAGAAAGG - Intergenic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
987436283 5:17897549-17897571 TTACTTTAGAAAATAGAGAATGG + Intergenic
987544709 5:19298595-19298617 TTATATTTTAATATAAAGATAGG + Intergenic
987546977 5:19323210-19323232 TTATATTGGTAGATTGAAAATGG - Intergenic
987801029 5:22697174-22697196 TGATATTAAATTATAGAGAAGGG + Intronic
988115112 5:26876983-26877005 TTATTTTTAAAAATAGAGAAAGG + Intergenic
989023287 5:37036044-37036066 TTTGATTGGAATAGGGAGAAAGG + Intronic
989393722 5:40930062-40930084 TGTTATGGGAATATAGATAAGGG - Intronic
989707851 5:44359274-44359296 TTATATTGGCACACAGGGAATGG + Intronic
990445598 5:55890973-55890995 TTCTATTTCAATATAGAAAAGGG - Intronic
991219386 5:64194895-64194917 TCATATTGAAATATACAGATAGG + Intronic
992963432 5:81977960-81977982 TTATTTTGGAAAATAAAAAAAGG - Intronic
993013631 5:82511232-82511254 TCAGTTAGGAATATAGAGAAAGG - Intergenic
993339871 5:86711131-86711153 TAAGATTAGAATATAGAAAAAGG - Intergenic
994038203 5:95226625-95226647 TTCTCATGGAAAATAGAGAAAGG - Intronic
994404799 5:99331512-99331534 TTATTATTGAAGATAGAGAATGG + Intergenic
994851734 5:105063613-105063635 TTATATTGACATTTAGAAAAAGG - Intergenic
994958650 5:106568067-106568089 TTAGATAAGAATATAGGGAAAGG - Intergenic
995079014 5:108024662-108024684 CTCTTTTGGAATACAGAGAAAGG + Intronic
995288355 5:110418542-110418564 ATATATAGATATATAGAGAAAGG - Intronic
995345973 5:111118012-111118034 ATATATTTGAACAGAGAGAATGG - Intronic
995917602 5:117268086-117268108 TTAAAATGTAATATAGATAAGGG + Intergenic
996222979 5:120955064-120955086 TGATATTGGTGTATATAGAAAGG + Intergenic
996244217 5:121240579-121240601 TTATATAGATATATAAAGAAAGG - Intergenic
996347799 5:122506177-122506199 TTACACAGGACTATAGAGAATGG - Intergenic
996827140 5:127697379-127697401 TTACATTGAAATATGAAGAAAGG + Intergenic
996914354 5:128694378-128694400 TAATTTTGGAATAGAAAGAATGG - Intronic
997934062 5:138095511-138095533 TTATTTTAGAAGATAGAGAAAGG + Intergenic
998440165 5:142153561-142153583 TTATATTTGATAATAGAGAAGGG + Exonic
998782587 5:145674605-145674627 TTATATTGGTATATGGAGTGAGG - Intronic
998883783 5:146672889-146672911 TTGTCTTGAAATATAGAAAATGG + Intronic
999598842 5:153237492-153237514 TTATACTGTAAGATACAGAAAGG + Intergenic
1000362250 5:160458417-160458439 TCATTTTTGAACATAGAGAAAGG - Intergenic
1001973879 5:175980506-175980528 TAAAATTGGAAAATACAGAAAGG - Intronic
1002243553 5:177863273-177863295 TAAAATTGGAAAATACAGAAAGG + Intergenic
1003170337 6:3716755-3716777 TTATTTTTGAATAGAAAGAATGG + Intergenic
1003369147 6:5507989-5508011 TTTTATAGGCAAATAGAGAAAGG + Intronic
1007241533 6:40430108-40430130 ATATATAGGAATATATAGATAGG - Intronic
1011033526 6:82948467-82948489 CTATTCTGGAAAATAGAGAATGG + Intronic
1011205183 6:84885781-84885803 CTATATACGAATATACAGAATGG + Intergenic
1011486486 6:87847082-87847104 CCATAGTTGAATATAGAGAAGGG - Intergenic
1011777530 6:90748383-90748405 TTATATAGGAAGAGAGAGATTGG + Intergenic
1011995199 6:93577902-93577924 TGATATTGTAATACAGATAAAGG + Intergenic
1014017092 6:116544971-116544993 TTAACCTGGAATATATAGAAAGG + Intronic
1014092606 6:117421178-117421200 TTATATTGGAATATATGAATTGG + Intronic
1014153953 6:118090448-118090470 TTAAATTGAAATATTAAGAAAGG + Intronic
1014380601 6:120736181-120736203 CTATATTTTAATATAGATAATGG - Intergenic
1014384480 6:120783889-120783911 ATATATTTGAGTAAAGAGAATGG + Intergenic
1014610282 6:123535131-123535153 TTCTATTTGAATTTTGAGAAGGG + Intronic
1014685019 6:124486467-124486489 GTATTTTGGAATATTGATAATGG + Intronic
1016179330 6:141124595-141124617 TCATAATGGAATACACAGAAAGG - Intergenic
1016256082 6:142107226-142107248 TTATTGTGGAATAAAGAGAGTGG - Intergenic
1017393780 6:153972681-153972703 TTTTATTGGAACATAGCTAATGG - Intergenic
1018590923 6:165421268-165421290 TTATATTGTTTTGTAGAGAAGGG - Intronic
1020937844 7:14489912-14489934 TTATACTGGGACAGAGAGAAGGG + Intronic
1020969136 7:14912083-14912105 TTTTATTGGAATATAAATAGAGG + Intronic
1021018872 7:15571051-15571073 TCATATTGTAATATATAGTATGG + Intergenic
1021483429 7:21143408-21143430 TTTTCTTGGAAAAGAGAGAAAGG + Intergenic
1022314962 7:29237175-29237197 TTATAATGGAAAATGGAAAAGGG - Intronic
1022545054 7:31179178-31179200 TTATACACGAATAAAGAGAATGG + Intergenic
1022551581 7:31245009-31245031 TCATATTTGAAAACAGAGAAAGG - Intergenic
1022584734 7:31596765-31596787 TTATATTGGAATATAGAGAATGG + Intronic
1023577208 7:41641101-41641123 TTATCTGAGAATATAGAAAAAGG - Intergenic
1023672617 7:42593977-42593999 TTATCTTGGAATATCCAGATGGG + Intergenic
1023776029 7:43608108-43608130 TTATTTTGAAAAATAGAGATGGG - Intronic
1025954750 7:66174218-66174240 TTATTTTGTTATATAGAGATGGG + Intergenic
1027464644 7:78500706-78500728 ATATAATGGAATATAGTAAAAGG + Intronic
1027752974 7:82174583-82174605 TTTTATAGGAATCTAAAGAATGG - Intronic
1028072011 7:86461697-86461719 TTATTTTGATATATATAGAAGGG + Intergenic
1028488005 7:91381124-91381146 TTGGATTTGAATAAAGAGAATGG - Intergenic
1028602766 7:92620459-92620481 AAATATTGGAATAGAGAGAACGG - Intronic
1028721430 7:94036683-94036705 TGAATTTGGAATATAGAAAAAGG + Intergenic
1030566074 7:111158101-111158123 TTATTTTTGTATATAGAGTATGG - Intronic
1031316803 7:120268672-120268694 TTATAATGGACTATTGTGAATGG + Intergenic
1031359940 7:120837228-120837250 TCATATAGGTATATAGTGAAAGG - Intronic
1031698000 7:124884686-124884708 TAATATTTGAATTTAGAGGAAGG - Intronic
1031778015 7:125925175-125925197 TACTATAGGAATATAAAGAATGG + Intergenic
1031829061 7:126603618-126603640 TTCTAACAGAATATAGAGAAAGG + Intronic
1032828253 7:135594194-135594216 TTATACTGCAATATAAAGTATGG - Intronic
1033510534 7:142056238-142056260 TTAGATTGAAATAAACAGAAAGG - Intronic
1033845103 7:145422160-145422182 TTATATTGGAAGCTTGAAAATGG + Intergenic
1036513006 8:9418059-9418081 TTGTATTGGAACATAGGAAATGG - Intergenic
1037371278 8:18181972-18181994 TTGTATTGGAATTTAGAGTCAGG - Intronic
1038889372 8:31701726-31701748 TTATGTTGGAATAGAGAGATGGG - Intronic
1041598378 8:59684711-59684733 TTATCTTTGAATCCAGAGAAGGG + Intergenic
1042102881 8:65293197-65293219 TTATTTTGAAATATATTGAATGG - Intergenic
1043177380 8:77039453-77039475 TTCTAGTGGAATATAGAGTTTGG - Intergenic
1043203859 8:77410408-77410430 TGTTATTGGAATAAAGTGAAAGG - Intergenic
1043590976 8:81833839-81833861 AGTTATTGGAATATAGAGAAGGG - Intronic
1043798951 8:84582160-84582182 ATATATTGAAATATATAGATAGG - Intronic
1043862709 8:85339015-85339037 TTATAGTACAATATAGAAAAGGG - Intronic
1045317509 8:101056121-101056143 TTATATAGGAAGGTAGATAAGGG + Intergenic
1046053405 8:109050785-109050807 TTATATTTGAATATTCATAACGG + Intergenic
1046093369 8:109529303-109529325 TTATAGCTGAATATAGACAAGGG + Intronic
1046580791 8:116090176-116090198 CTAGAGTGAAATATAGAGAAAGG - Intergenic
1046773884 8:118143559-118143581 TTATAATGACAGATAGAGAACGG - Intergenic
1046802155 8:118440305-118440327 CTTTCTTGGAATACAGAGAAAGG - Intronic
1048246505 8:132808880-132808902 TTATTTTTTAATATAGAGATGGG + Intronic
1048406086 8:134123563-134123585 TTATGATGGAATAGAGAGAAAGG + Intergenic
1048777865 8:137967547-137967569 TTAGATAGGAATTTGGAGAAGGG - Intergenic
1049877542 8:145035301-145035323 TTATTTGGGATTATAGAGTAAGG - Intergenic
1050342063 9:4650267-4650289 TAATAGCAGAATATAGAGAAAGG - Intronic
1051019012 9:12517288-12517310 TGACATTGGAATATAGAACATGG + Intergenic
1051421399 9:16892946-16892968 TTAAATTGACATATAGAAAAAGG + Intergenic
1052544831 9:29863470-29863492 TTGTCTTAGAATATAGAAAAAGG + Intergenic
1052918325 9:33941214-33941236 TAATACTGGACTATAGATAAAGG - Intronic
1055387876 9:75783515-75783537 TTATTTTTGTATATAGTGAAAGG + Intergenic
1055810669 9:80144175-80144197 CTCTATTGGAACAGAGAGAAAGG + Intergenic
1058757994 9:108101707-108101729 TCATATCAGAATGTAGAGAAGGG - Intergenic
1203681041 Un_KI270756v1:64370-64392 TTTTATGGAAATATATAGAATGG - Intergenic
1186926721 X:14341454-14341476 TTATCTTTCAATATATAGAACGG - Intergenic
1186964769 X:14775318-14775340 TTGTATTGAAAGATAGAGGAAGG - Intergenic
1187398637 X:18939884-18939906 TTATGTTGGAATATTGGAAAGGG - Intronic
1187760995 X:22584601-22584623 TTATATTGGAAAGTAAAGGAGGG + Intergenic
1188745433 X:33835586-33835608 ATAAATTGGAAAATATAGAATGG - Intergenic
1189061325 X:37756270-37756292 TTAGATGAGAATACAGAGAATGG - Intronic
1189823139 X:44889985-44890007 TGATATTGAAATATAGTCAAGGG + Intronic
1189940793 X:46118310-46118332 TTATATTCAAAGATACAGAAAGG - Intergenic
1190141237 X:47847073-47847095 ATATGTTTGAATATATAGAAAGG - Intronic
1190237721 X:48630296-48630318 TTATTTTTGAAAATAGAGACAGG + Intergenic
1190445197 X:50516939-50516961 TACTATAGGAACATAGAGAAGGG - Intergenic
1192032941 X:67534000-67534022 GTATATTGGGAAAAAGAGAAAGG + Intergenic
1192194736 X:69020745-69020767 TTATTTTGGAAAATAAATAAGGG + Intergenic
1193797529 X:85894563-85894585 GTATTTTGGAATTTAGATAATGG - Intronic
1194433229 X:93837579-93837601 ATATAATGGATTTTAGAGAAGGG - Intergenic
1196406925 X:115373202-115373224 ATACATTGGATTTTAGAGAAAGG + Intergenic
1196672188 X:118380627-118380649 TGATATTGTAATATAAAGGAAGG + Intronic
1197848777 X:130834118-130834140 CTATAGTGGAAGTTAGAGAATGG - Intronic
1198840898 X:140856792-140856814 TTTTATAGAAATTTAGAGAAGGG - Intergenic
1199446860 X:147934449-147934471 TTAAATTGGAAGATATAGTAGGG + Intronic
1199907938 X:152253972-152253994 AGTTATTGGAATATAGAGCAGGG - Intronic
1201635968 Y:16123554-16123576 TTTTATTGTATTTTAGAGAATGG + Intergenic
1201950606 Y:19559316-19559338 TAATATTGGCATGTAGGGAAAGG - Intergenic