ID: 1022589641

View in Genome Browser
Species Human (GRCh38)
Location 7:31649530-31649552
Sequence TGTTAACAAGAATACTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022589641 Original CRISPR TGTTAACAAGAATACTTTAG AGG (reversed) Intronic
903203177 1:21760320-21760342 TGTTATCAGTAATCCTTTAGTGG - Intronic
904241767 1:29151185-29151207 TTTTAGCAAGAATACTTCATAGG - Intronic
907056671 1:51375325-51375347 TGATAACAAGTATATTTTAGAGG + Intronic
907645625 1:56240068-56240090 TTTTAACAAGACAACTTTATAGG - Intergenic
908708336 1:66986562-66986584 TGTTAACAGTAATACTTCATGGG - Intronic
909057595 1:70840759-70840781 TTATAAAAAGAATACTTTAGAGG + Intergenic
909819177 1:80038229-80038251 TGCTAGCAAAAATACTTTGGAGG - Intergenic
910356299 1:86360141-86360163 GATTAACAAGAATACATTAAGGG + Intronic
913012648 1:114699684-114699706 TGTTTACAACATTATTTTAGTGG + Intergenic
914695550 1:150075443-150075465 TCTTGGCAAGAATACTTTATAGG + Intronic
915293587 1:154903393-154903415 ATTTAAAGAGAATACTTTAGTGG - Intergenic
917228659 1:172812558-172812580 TTTTAACAAGAAGACTGAAGAGG + Intergenic
917785567 1:178452931-178452953 TGCTGATAAAAATACTTTAGTGG + Intronic
918153756 1:181822668-181822690 TCTTAACAACAAAACTTTAAAGG + Intergenic
918187196 1:182138548-182138570 TAATAATAATAATACTTTAGGGG + Intergenic
919113152 1:193245191-193245213 TGTTAACTATAATCCTATAGTGG + Intronic
919294752 1:195682373-195682395 TCTGAACAATAATAATTTAGAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923117152 1:230952234-230952256 GGTAAACAAGAATAATTTGGAGG - Intronic
924635565 1:245784595-245784617 TATCAACAAGAGTACTTAAGTGG + Intronic
1063100149 10:2943192-2943214 TGTTAACCAGCATACTTTCTTGG + Intergenic
1063799268 10:9554356-9554378 TGTTAAAAGGAAAACTTTAGTGG + Intergenic
1064850560 10:19704776-19704798 TGTAAACCAAAATACTTTGGTGG + Intronic
1065044485 10:21734623-21734645 TGTTATTAAGCATACTTTTGGGG + Intronic
1065962714 10:30747026-30747048 TGTGAACAAAAATAGTTTTGTGG - Intergenic
1067164579 10:43855218-43855240 TCTTAACAAGAACCCTGTAGAGG - Intergenic
1068691185 10:59916555-59916577 TTTTAGCAAGAATACTTCATAGG + Intergenic
1068702583 10:60035673-60035695 TGTTAACAGGAATTTTTTAAGGG + Intronic
1068777764 10:60886554-60886576 TGTTAACAAGGATAAATGAGTGG - Intronic
1071045275 10:81366304-81366326 TATTGACAAGAGTACTTTTGTGG - Intergenic
1072352469 10:94570260-94570282 TTTTAATAAGAATACTTCATTGG + Intronic
1074340105 10:112620027-112620049 TGTTGCCAGAAATACTTTAGAGG - Intronic
1076003409 10:126929841-126929863 CGTTAACAAGAACAATTCAGTGG + Intronic
1078126381 11:8568308-8568330 TGTTATGAATAATACTTTGGAGG - Intronic
1079680940 11:23297511-23297533 TTTTAACAAAAATATTTTAAAGG + Intergenic
1080180139 11:29416031-29416053 TTTTAAGAAAAATAATTTAGGGG - Intergenic
1081141826 11:39510767-39510789 TATTAAAAAGAAAAGTTTAGGGG - Intergenic
1085149411 11:74237208-74237230 TGTTTGCAAGAATACTTGATAGG + Intronic
1093799603 12:23357241-23357263 TGGTAATAAGAATATTTTAGGGG + Intergenic
1094033975 12:26047390-26047412 TTTTAACTAGAATTCTTGAGAGG + Intronic
1095314176 12:40739369-40739391 TGTGATCAAGAACATTTTAGAGG - Intronic
1097839703 12:64309851-64309873 TTTTAACAAAAATACTTCATAGG + Intronic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098369790 12:69745506-69745528 TGATAACAAAAATAATATAGGGG + Intronic
1098845867 12:75534937-75534959 GGCTAACAAGAATAATTTGGGGG - Intergenic
1099472496 12:83068756-83068778 TGGTTACATGAGTACTTTAGTGG + Intronic
1100150045 12:91725629-91725651 TGTTAAAAAGAATAAGTTAAAGG - Intergenic
1100436443 12:94575642-94575664 TTTTAACAAACATATTTTAGTGG - Intronic
1101939037 12:109085610-109085632 TTTTAACAAAAAGACTTTATAGG - Intronic
1105060029 12:133140983-133141005 TGTTCCCAATAATCCTTTAGAGG - Intronic
1105577326 13:21666340-21666362 TTTTAACAAGAAAAATTAAGGGG - Intergenic
1105777095 13:23673075-23673097 TATTAACAACAATTCTTTTGTGG - Intronic
1107162420 13:37246725-37246747 TGTTTAGAAGAAAAATTTAGAGG - Intergenic
1109530952 13:63646313-63646335 TGTGTACAAGAACACTTAAGGGG - Intergenic
1110489690 13:76088430-76088452 TGTTAATAAAAATCCTTTGGAGG + Intergenic
1110954668 13:81539296-81539318 TATTAGCAAGAATACTTAAGAGG + Intergenic
1111815403 13:93146841-93146863 TTTTAATAAGAATACTTTATGGG + Intergenic
1116380842 14:44265950-44265972 TGTTAATAAGAAGACTTAGGAGG + Intergenic
1117708154 14:58494873-58494895 TGTTAATAAGAAGACTTTTATGG + Intronic
1121572215 14:94954979-94955001 TGTTAACATGCATATTTTAAGGG + Intergenic
1123155547 14:106221473-106221495 TGTTATTAAGAATAGTTTTGTGG + Intergenic
1123402205 15:19998613-19998635 TGTTATTAAGAATAGTTTTGTGG + Intergenic
1123511546 15:21005279-21005301 TGTTATTAAGAATAGTTTTGTGG + Intergenic
1123805500 15:23867950-23867972 TGCTAACAAAAATACTGCAGTGG - Intergenic
1126221269 15:46216333-46216355 CAATAACAAGCATACTTTAGTGG - Intergenic
1128802695 15:70506929-70506951 TGTTTTTAAGAATAATTTAGTGG - Intergenic
1130901614 15:88211053-88211075 TCTTAACATGTATAATTTAGTGG + Intronic
1131572925 15:93557429-93557451 TCTTAACAAGAATTCATTTGGGG + Intergenic
1131672772 15:94637838-94637860 TGTTAATAAGAATGCTTTTAAGG - Intergenic
1131683383 15:94747159-94747181 TGATAACAACAATTCTATAGAGG - Intergenic
1134374955 16:13663413-13663435 TATTCCCAAGAATACTTGAGTGG + Intergenic
1134771814 16:16815672-16815694 TGTTCACAAGGAAACTTCAGAGG - Intergenic
1135293122 16:21257209-21257231 TTTTAACATGGATACTGTAGTGG + Intronic
1135795714 16:25440603-25440625 TGTCTACAATAATACTTTAGAGG + Intergenic
1137999387 16:53259066-53259088 TTTTAAGAAGAAAAATTTAGGGG + Intronic
1139083562 16:63556854-63556876 TGTAAATAAGCAAACTTTAGTGG - Intergenic
1139097775 16:63726423-63726445 TTTTTACAAAAATAATTTAGTGG - Intergenic
1139843343 16:69900325-69900347 TGTTAAAAAGAATTTTTTAGAGG + Intronic
1140562974 16:76005582-76005604 TGTTAACAAAAATGCCTTAACGG + Intergenic
1141215778 16:82021676-82021698 TTTTAAAAAAAATCCTTTAGGGG - Intergenic
1141392795 16:83678552-83678574 TGTTAACAAGTTTAATTTAATGG - Intronic
1143555281 17:7655976-7655998 TGTTATCAAAAATACCTTTGGGG - Exonic
1149208452 17:54276524-54276546 TGCTAACAAGAGTCCTTGAGAGG - Intergenic
1149852898 17:60051632-60051654 TGTTGACATGGCTACTTTAGAGG - Intronic
1150944552 17:69730810-69730832 TGTTAGCAAGAATAATGCAGTGG - Intergenic
1152219806 17:79057156-79057178 TAATAATAAGAATACTTTATTGG + Intergenic
1153593172 18:6696216-6696238 TTTTTACAAGAATACTTCAAAGG + Intergenic
1155809924 18:30219432-30219454 TGATATTAAGAATACTTTAGTGG - Intergenic
1156056591 18:33012593-33012615 TGTTAAGAAAAATATTTTAGGGG - Intronic
1156875199 18:42002170-42002192 TTTCAACAAGATGACTTTAGAGG + Intronic
1159156089 18:64584621-64584643 TTTTAAAAGGAATACTTAAGAGG + Intergenic
1159227108 18:65554095-65554117 TGTGAACAAGAATAGCTTTGTGG + Intergenic
1164186706 19:22875962-22875984 TTTTAAAAAGAATATTTTTGAGG + Intergenic
1165664478 19:37615547-37615569 TTTTAGCAAGAATACTTCATAGG + Intronic
1167813031 19:51851839-51851861 TGTTTACAAGAATACCTTGTGGG - Intergenic
927732014 2:25482088-25482110 TGTTAGAAAGAATTCTTTAATGG + Intronic
929426815 2:41852166-41852188 TTTTATCAAGAATGCTTTATTGG - Intergenic
930275543 2:49306493-49306515 TCTTAACCAAAATATTTTAGAGG - Intergenic
931051768 2:58423778-58423800 TTTTAACAAAAATCCTTTTGTGG + Intergenic
932244240 2:70183135-70183157 GGTTGTCAAGAACACTTTAGAGG + Intronic
932784222 2:74585750-74585772 TGTAAACCAGAACATTTTAGAGG + Intronic
935342599 2:102071113-102071135 TGCTACCAAGAGTACTTCAGAGG + Intronic
936672285 2:114671011-114671033 AGTGAACAAGAATTCTTTAAGGG - Intronic
936958383 2:118046705-118046727 AGTTAAGAAAAATATTTTAGGGG + Intergenic
937091701 2:119210848-119210870 TGAGAACACGAATCCTTTAGTGG - Intergenic
937282077 2:120725008-120725030 TTTCAACAAGAATACTTCATAGG + Intergenic
937434989 2:121873050-121873072 TGTTCACAGGAATTCTTTACAGG - Intergenic
939538641 2:143464446-143464468 TGTTAATAAGAATTCTTTTTAGG - Intronic
940737972 2:157474653-157474675 TCTTAACCAAAATATTTTAGAGG + Intronic
942303302 2:174583132-174583154 TTTTAACAAGCATGCTTCAGCGG - Intronic
945046966 2:205790116-205790138 GGTGAAGAAGAACACTTTAGTGG - Intronic
945325287 2:208474753-208474775 TTTTAAAAAGAAAACTCTAGAGG + Intronic
947086844 2:226462391-226462413 TGTTTTTAAGATTACTTTAGGGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1172877325 20:38173060-38173082 TATTAACAAAAGTATTTTAGGGG - Intergenic
1173272453 20:41550099-41550121 TGTTAAAAAGAAGACATTACTGG - Intronic
1173381862 20:42552034-42552056 TGTTGAAAAGAATTCTCTAGAGG - Intronic
1174544189 20:51313117-51313139 TGTGAACAATAAACCTTTAGTGG - Intergenic
1174724336 20:52845479-52845501 TGTTAATAAGAATACCTTGCTGG - Intergenic
1176376890 21:6091284-6091306 TGTTTAAAGGAATCCTTTAGGGG + Intergenic
1177814230 21:25958574-25958596 TGTTAACATGAATAATTAATTGG - Intronic
1178516932 21:33255887-33255909 TGTTAACAAGCCTCTTTTAGGGG - Intronic
1178973902 21:37205742-37205764 TGTTAAGAAGAATAATTTGGGGG + Intergenic
1179746585 21:43446960-43446982 TGTTTAAAGGAATCCTTTAGGGG - Intergenic
949353201 3:3147236-3147258 TGGAAACAAGAACATTTTAGAGG + Intronic
949730049 3:7098910-7098932 TATGCACAAGCATACTTTAGTGG + Intronic
949963400 3:9334083-9334105 TATTAACAATAATACTTCACAGG + Intronic
953393791 3:42550224-42550246 TGTTGAAAACAAAACTTTAGAGG - Intronic
956247810 3:67203783-67203805 TGTAAACAATACTACTTTAAAGG - Intergenic
959051838 3:101531732-101531754 TGTTTACAAGGAAACTTTGGTGG + Intergenic
960350070 3:116581739-116581761 TTTTAACAAGGATACTTTTAAGG - Intronic
960387864 3:117042983-117043005 TGTTTGCAAGAATACTTCATGGG - Intronic
961243697 3:125433829-125433851 TATTAACAATAATAGTTTTGTGG - Intergenic
971249388 4:24960574-24960596 TGTTAACAATAATTTTTTAAAGG + Intronic
971609416 4:28703314-28703336 TGTTAAGAAAAATACTTTATGGG + Intergenic
972824842 4:42745721-42745743 TTTTGACAAGAACACTTCAGAGG - Intergenic
977050583 4:92124370-92124392 TGTTGGGAAGAACACTTTAGGGG + Intergenic
977843053 4:101732891-101732913 TCTTAAACAGAATAATTTAGAGG + Intronic
978207901 4:106101747-106101769 TGTAAACAGCAATACTTTAAAGG - Intronic
978553473 4:109953117-109953139 TGTTTTCAAGAATGCTTTATGGG + Intronic
979183716 4:117760536-117760558 TGTTAACATTAATACTGGAGGGG + Intergenic
979833611 4:125332370-125332392 TGTCAACAACAATACAATAGTGG - Intronic
980039481 4:127922973-127922995 TTTTGGCAAGAATACTTTATAGG - Intronic
980334199 4:131449217-131449239 TGATAACGTGAATACTTTTGAGG + Intergenic
980465892 4:133180618-133180640 TTTTAACCAGAATTCTTTACTGG + Intronic
980748961 4:137063346-137063368 TTTTAAGAGGAATACTTTAAAGG + Intergenic
981979296 4:150772012-150772034 TGTTGACAAAAAAAGTTTAGGGG - Intronic
982028132 4:151272773-151272795 TTTTAACAAGGATACTTCATAGG + Intronic
982626192 4:157769365-157769387 TCCTAAGAAGAATACATTAGTGG + Intergenic
983139529 4:164132435-164132457 TGTTGGCAAGAATACATTAGAGG + Intronic
985137680 4:186803728-186803750 TGCTAACAACAATACTTTTATGG + Intergenic
987931230 5:24401354-24401376 TGTTAACATAAATAATTTATAGG + Intergenic
988826268 5:34938446-34938468 TTTTAATAACAAAACTTTAGAGG - Intronic
990280344 5:54243784-54243806 TGTCAAGCAAAATACTTTAGAGG - Intronic
992070137 5:73140789-73140811 TTTAAACAAAAATACTTTAGAGG + Intergenic
993598308 5:89887700-89887722 TGTAAACAAGAATTGTTTTGAGG - Intergenic
993667375 5:90717152-90717174 TGACAACAAGAATAGTTTATTGG + Intronic
993976355 5:94487578-94487600 TGTTAACAATAAGAGTTTAAGGG - Intronic
994499175 5:100552666-100552688 TTTTATCAAGCTTACTTTAGTGG + Intronic
994859809 5:105175830-105175852 TGTTTACCTAAATACTTTAGTGG + Intergenic
995579719 5:113583845-113583867 TTTTAACAAGAATATTTTATAGG + Intronic
995924775 5:117358195-117358217 TGTTAACAAGAATAGTGCTGAGG + Intergenic
996691902 5:126349045-126349067 TGTTTCCAAGAAAACTTAAGAGG - Intergenic
997177219 5:131791828-131791850 TATTAACAATAATACTATAGTGG + Intronic
997706498 5:135958638-135958660 TTTTGACAAGAATACTTTATAGG - Intergenic
998611888 5:143698235-143698257 TGCTAACAACATAACTTTAGAGG - Intergenic
999403891 5:151289745-151289767 TTTTAGCAAGAATACTACAGAGG + Intronic
1000213669 5:159134221-159134243 TCTTAACAAGAATATCTCAGAGG + Intergenic
1000569661 5:162895994-162896016 TGTTGGCAAAAACACTTTAGCGG - Intergenic
1003801911 6:9679645-9679667 GGTTAAAAAAAATACATTAGTGG - Intronic
1004461808 6:15843637-15843659 TGAAAACAAGAATACCTGAGTGG - Intergenic
1005171031 6:22984907-22984929 TGTTAACAGCAATACTTAAAAGG + Intergenic
1006290806 6:33135068-33135090 TGTAATCAAGAATACTTTTTGGG + Intergenic
1008019770 6:46563088-46563110 TGTAAAGAAAAAAACTTTAGTGG - Intronic
1008254917 6:49286032-49286054 TGTATACAAGCATACTTTGGAGG + Intergenic
1011848987 6:91602599-91602621 TGTTACTAAGAATAATTTGGTGG - Intergenic
1012453102 6:99374582-99374604 TAATAATAATAATACTTTAGGGG + Intronic
1012577427 6:100819891-100819913 TATTAACAATAATACATTACTGG + Intronic
1013754663 6:113446854-113446876 TGAGTACAAGAAAACTTTAGAGG + Intergenic
1013787837 6:113801974-113801996 TTTTGGCAAGAATACTTTAAAGG - Intergenic
1014160254 6:118159307-118159329 TGTCAACAAAACTACTTTGGTGG - Intronic
1014579810 6:123123249-123123271 TTTTACAAAGAATACGTTAGTGG + Intergenic
1015220195 6:130795698-130795720 TGTTTAAAAGAATCCTTAAGTGG - Intergenic
1016326414 6:142907617-142907639 TGTTAACAAGCCTCCTTTTGGGG + Intronic
1017864740 6:158433311-158433333 TTTTGGCAAGAATACTTTAAAGG + Intronic
1018606330 6:165601622-165601644 TCTTAACACGAAAACTTCAGGGG - Intronic
1018883350 6:167907397-167907419 TGTTAGCAATAATATTTTAAGGG + Intronic
1021178566 7:17479320-17479342 AATTAATAAGAATACTATAGAGG + Intergenic
1022119693 7:27296111-27296133 TTTTGGCAAGAATACTTTATGGG - Intergenic
1022302428 7:29113876-29113898 GGTGAAGAAGAATCCTTTAGTGG + Intronic
1022589641 7:31649530-31649552 TGTTAACAAGAATACTTTAGAGG - Intronic
1024371564 7:48589956-48589978 TTTTAACATGAATTCTGTAGGGG + Intronic
1024465148 7:49704197-49704219 TGTAAAAGAGAATACTTAAGGGG + Intergenic
1024761487 7:52602315-52602337 TGGAAACAAGAATACTACAGGGG + Intergenic
1024837915 7:53545698-53545720 TGATAAGAAGAAAATTTTAGTGG + Intergenic
1026170291 7:67947966-67947988 TCTTTACAAGATTATTTTAGGGG - Intergenic
1027366608 7:77465129-77465151 TGTAAACAATACTACATTAGTGG + Intergenic
1027694325 7:81390059-81390081 AGTTAAAAAGAAAACTTTTGAGG + Intergenic
1027769939 7:82393407-82393429 TGTTAACATGGATACAGTAGTGG - Intronic
1027933558 7:84571471-84571493 TATTAAAAACATTACTTTAGGGG + Intergenic
1028235757 7:88359898-88359920 TGCTACCAAGACTACTTTACTGG + Intergenic
1030505417 7:110416136-110416158 TGTTACAAAGAATACATTAAGGG + Intergenic
1031006532 7:116479486-116479508 TATTAAAAAAAATAGTTTAGAGG - Intronic
1033002079 7:137517063-137517085 TTTTAGAAAGAATACTGTAGAGG - Intronic
1033940898 7:146652011-146652033 TGTGAAGAAGGATACTTTAAAGG + Intronic
1034635917 7:152567022-152567044 TGTTAAAAAGATTACTCTAGTGG - Intergenic
1039124095 8:34181270-34181292 TGGTTACATGAATTCTTTAGTGG - Intergenic
1040692919 8:49961594-49961616 TGCTAAGAATAATATTTTAGTGG + Intronic
1040714791 8:50237332-50237354 TTTTGGCAAGAATACTTTATTGG + Intronic
1041596376 8:59658176-59658198 TGAAAGCAAGAATAGTTTAGAGG - Intergenic
1042450793 8:68943046-68943068 TTTTAACATAAAAACTTTAGGGG - Intergenic
1042785460 8:72540977-72540999 TGCTCCCAAGAATATTTTAGGGG + Intronic
1045428977 8:102095673-102095695 TTTTAACAAGAATACTGTCTTGG - Intronic
1046213024 8:111103588-111103610 TATTAACAGGAATACTGTAATGG - Intergenic
1050879891 9:10686293-10686315 AGTTCACAAGAATAATTTTGAGG - Intergenic
1051008625 9:12381678-12381700 TTTTAGCAAGAGTACTTTATAGG + Intergenic
1052069153 9:24059884-24059906 TGTAAACAAGACTACTGCAGAGG - Intergenic
1052716193 9:32120488-32120510 TTTTAACCATAACACTTTAGTGG + Intergenic
1052998816 9:34566074-34566096 TGTTAACAAGCCTAATTAAGAGG - Intronic
1053085321 9:35215113-35215135 TGTAAATAAATATACTTTAGTGG + Intronic
1053559136 9:39171196-39171218 TGGTCAAAAGAACACTTTAGTGG + Intronic
1053823254 9:41991437-41991459 TGGTCAAAAGAACACTTTAGTGG + Intronic
1054137975 9:61447750-61447772 TGGTCAAAAGAACACTTTAGTGG - Intergenic
1054607319 9:67195928-67195950 TGGTCAAAAGAACACTTTAGTGG - Intergenic
1055085142 9:72306134-72306156 TGTTCACCTGAATAATTTAGGGG - Intergenic
1055781397 9:79825132-79825154 TGTTAACAAGAATAGAAAAGTGG - Intergenic
1056318930 9:85418505-85418527 TGGTAACAGGAATGCTTCAGAGG - Intergenic
1056875642 9:90327325-90327347 TCTTAAGATGAATACTTTAAGGG - Intergenic
1057714601 9:97481591-97481613 TGCTAGCTAGAATAATTTAGAGG - Intronic
1057887079 9:98838144-98838166 TGCTAACAAGAAGGCTCTAGAGG - Intronic
1058313057 9:103530242-103530264 TGATAACATGAATAACTTAGAGG + Intergenic
1185982717 X:4797367-4797389 TTTTATCAAAAATACTTTATAGG - Intergenic
1186908307 X:14134749-14134771 TGTAAACAAAAATACTTTCCTGG + Intergenic
1187015276 X:15321105-15321127 TGTTTACAAGTTTTCTTTAGGGG - Exonic
1187925030 X:24242141-24242163 TATTAACAAGAATATTTGATTGG + Intergenic
1189557128 X:42156540-42156562 GTTTAACAAAAATATTTTAGGGG - Intergenic
1189842859 X:45100182-45100204 TGTTAAAAAAAATACTTCAGAGG - Intronic
1189850897 X:45175098-45175120 TGGGAACAAGAATATCTTAGAGG + Intronic
1190566940 X:51740513-51740535 TTTTAACAAGAATACTTCAAGGG - Intergenic
1192089525 X:68138969-68138991 TTTTGGCAAAAATACTTTAGAGG - Intronic
1193368736 X:80666705-80666727 TGTTAACAATAATACCTAATAGG + Intergenic
1193460212 X:81782150-81782172 TTTTAACAAGATTATTTTATAGG + Intergenic
1195039905 X:101004460-101004482 TTTTGACAAGAATACTTAAGTGG - Intergenic
1196503916 X:116418309-116418331 TTTTAATAACAATCCTTTAGGGG + Intergenic
1197183968 X:123565809-123565831 GTTTAACAAGAATACTTTATTGG - Intergenic
1197661886 X:129182477-129182499 TTTTCACAAGAATACTTGATAGG - Intergenic
1198701697 X:139403883-139403905 TCTTAACAAAAATTATTTAGTGG + Intergenic
1199659040 X:150028802-150028824 TGTTAAAAGGAGTTCTTTAGGGG - Intergenic