ID: 1022593429

View in Genome Browser
Species Human (GRCh38)
Location 7:31688164-31688186
Sequence TATTACCCATAGAATGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022593429_1022593430 -7 Left 1022593429 7:31688164-31688186 CCATGCACATTCTATGGGTAATA 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1022593430 7:31688180-31688202 GGTAATACTCTCAACAACCCTGG 0: 1
1: 0
2: 2
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022593429 Original CRISPR TATTACCCATAGAATGTGCA TGG (reversed) Intronic
910233927 1:85014998-85015020 TATTATCCATTGAATGCCCATGG + Intronic
910512007 1:88017101-88017123 TATCAGCCATAAAATGTCCAAGG + Intergenic
911641646 1:100296165-100296187 TATTACCCAGAGTGAGTGCATGG + Intergenic
911858296 1:102911306-102911328 CATTAAACATAGAATGTGAATGG - Intronic
913092479 1:115487542-115487564 TATTATCCTTAAAATGTCCATGG - Intergenic
913611193 1:120511278-120511300 TGTTACCCATTAAATCTGCATGG - Intergenic
913983601 1:143545529-143545551 TGTTACCCATTAAATCTGCATGG + Intergenic
914579998 1:149010961-149010983 TGTTACCCATTAAATCTGCATGG + Intronic
916264374 1:162876115-162876137 TATTGGGCATAGAATGAGCATGG - Intergenic
917163573 1:172085672-172085694 TAAGACCCATAGAATTTTCATGG - Intronic
917812366 1:178671724-178671746 TATTATCCAAAGCATGGGCAGGG - Intergenic
919010345 1:191952091-191952113 TATTATCCTTTTAATGTGCATGG - Intergenic
920756051 1:208734136-208734158 TATTAAGCATAGAATGAACAAGG + Intergenic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921093502 1:211865723-211865745 TATTATCCTTTGAATGTCCATGG + Intergenic
922004723 1:221518295-221518317 TTTGACCAATAGAATGTGGATGG + Intergenic
1064591510 10:16897321-16897343 TGTAACCCACAAAATGTGCAAGG - Intronic
1070267317 10:74916542-74916564 TATTACCCAGAGAATGCTTATGG + Intronic
1070369485 10:75768370-75768392 TATTACCCATCTGATGTACAAGG - Intronic
1072370368 10:94760296-94760318 TATTACCCAGTGACTGTGGAGGG + Intronic
1073710702 10:106035657-106035679 TATTATCCTTATAATGTCCATGG + Intergenic
1078454525 11:11464901-11464923 TGTTGCCCATAGAATGTGAAAGG - Intronic
1081147509 11:39581207-39581229 TATCACAAACAGAATGTGCAAGG - Intergenic
1083384407 11:62296885-62296907 AAATACCCATAGAAGCTGCAGGG - Intronic
1087537283 11:99465395-99465417 TATAATGCATAGAAAGTGCAAGG - Intronic
1088969044 11:114755241-114755263 TATTACCCATAGGCTGTGTGGGG + Intergenic
1090174611 11:124637489-124637511 GATCACCCAAAGAATGTTCAGGG - Intronic
1090303574 11:125670378-125670400 TATTACACATAGAAAAAGCAGGG - Intronic
1090445920 11:126764608-126764630 TGTAACTCATAGAATGAGCAGGG - Intronic
1097356987 12:58612922-58612944 CATTACCCATAGGGTGGGCAGGG - Intronic
1098059160 12:66541434-66541456 GATGACCCATATAATGTGAATGG - Intronic
1099329779 12:81269290-81269312 TACTACCCATAGAAAGGGAAAGG + Intronic
1101891014 12:108715451-108715473 TATTACAGAGATAATGTGCAAGG + Intronic
1105322292 13:19339019-19339041 TAGTAACCATAGAATGTCCCCGG - Intergenic
1105657301 13:22455245-22455267 TATTTCCAAGAGCATGTGCAGGG - Intergenic
1105875383 13:24548127-24548149 TAGTAACCATAGAATGTCCCCGG + Intergenic
1108975937 13:56443285-56443307 CATTACCCATGTAATGTGAAAGG + Intergenic
1108975948 13:56443384-56443406 CATTACCCATGTAATGTGAAAGG + Intergenic
1109053864 13:57520234-57520256 AAATAACCATAGAATGTGCTGGG - Intergenic
1111167509 13:84479565-84479587 TCTTACTTATAGAATGTGCAGGG - Intergenic
1112951706 13:105005565-105005587 AATCACACATAGAATGTCCATGG + Intergenic
1113344717 13:109466186-109466208 TATTACATATAAAATGTCCAGGG + Intergenic
1115021937 14:28692421-28692443 GATAACACATAGAAAGTGCATGG + Intergenic
1116380711 14:44264338-44264360 TATTACCATTAGAATTTGAATGG + Intergenic
1117827024 14:59714596-59714618 TCTTACCAATAGAATGTGAGTGG - Intronic
1118272891 14:64360041-64360063 TATGACTCAAATAATGTGCAGGG - Intergenic
1120477613 14:85008285-85008307 TAATTCCCATAGATTGTGGAAGG + Intergenic
1121514534 14:94540624-94540646 TTTTACCCACAGAATGTGATAGG - Intergenic
1131748814 15:95482681-95482703 TACTGCTCATAAAATGTGCAAGG + Intergenic
1133681729 16:8126300-8126322 TACTAGCCAAAGAATGTCCAAGG + Intergenic
1140689822 16:77471051-77471073 TAATACCTTTAGAATGTGCCTGG + Intergenic
1141315278 16:82956715-82956737 TACTATCCCTAGAATGTGCCAGG + Intronic
1143348974 17:6272897-6272919 TATAACCCTGAGTATGTGCAAGG + Intergenic
1158801511 18:60916032-60916054 TATAACACATACAATGTGCCAGG + Intergenic
1158980827 18:62759853-62759875 TATTTCCCAAAGAAAGAGCAAGG - Intronic
1160135414 18:76267113-76267135 TTTGACCTATAGAAGGTGCATGG - Intergenic
1161916668 19:7233572-7233594 TATAAGGCATAGGATGTGCAGGG - Intronic
1163238526 19:16043820-16043842 TATGTCCCATAGAAGGTGCTTGG + Intergenic
1164794860 19:31017631-31017653 TAATCCCCATATATTGTGCAAGG - Intergenic
1166226484 19:41398949-41398971 TATTGCCCTTAGGATGTGCCAGG - Intronic
925316240 2:2926838-2926860 TGTTACCCTTATAATGTCCATGG + Intergenic
930025756 2:47028263-47028285 TAGTCCCCATAGGATGTGCTGGG + Intronic
933262464 2:80145966-80145988 TTTGACCCATAGAATGTGGCAGG + Intronic
935135918 2:100301649-100301671 TATCAGCCATAGAATGTCCAGGG + Intronic
939873641 2:147552191-147552213 TCTTTCTCATAGAATGTGAATGG + Intergenic
940382922 2:153036508-153036530 GAATAACCATAGAATGTGCTGGG - Intergenic
942566740 2:177272068-177272090 TATAACCCATATAAAGTACATGG - Intronic
943535734 2:189147729-189147751 CATTACCCAGAGAATGTTCTGGG + Intronic
945187136 2:207150607-207150629 TATTTCCCATATGAAGTGCAGGG - Intronic
947286432 2:228521168-228521190 TATCACCAACAGCATGTGCAAGG - Intergenic
948295200 2:236855420-236855442 TAATACTCATGGTATGTGCAGGG - Intergenic
948647839 2:239419419-239419441 TATTTCACTTAGAATGGGCACGG + Intergenic
1170666036 20:18386902-18386924 AATTTGCCATAGAATGTTCATGG + Intronic
1177752002 21:25296287-25296309 GAATAACCATAGAATGTGCAAGG + Intergenic
1179028816 21:37702388-37702410 TAATACCCATAGGATTTCCATGG + Intronic
950886075 3:16364014-16364036 TATTAACCAAAGAATGAGCAAGG + Intronic
951142007 3:19173403-19173425 TATGTGCCATACAATGTGCAAGG + Intronic
951700812 3:25494814-25494836 TTTTAAACATAGAATGTGTATGG + Intronic
952149809 3:30577145-30577167 TATTACTCATAGCAATTGCATGG + Intergenic
956384503 3:68702521-68702543 TTTCACCCATTGAATGTGAAAGG - Intergenic
959347197 3:105212292-105212314 TATCACCCATAGACTGAGAATGG + Intergenic
959923644 3:111897368-111897390 TTTTCCCCATATAATGTACAGGG + Intronic
962242831 3:133765644-133765666 TATTATCCATAGAATAAGAATGG - Intronic
967457548 3:189706004-189706026 TATTAGACATAGTATATGCATGG - Intronic
970732581 4:19124363-19124385 TATTTCACATAGAATGATCAAGG + Intergenic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
973222946 4:47750033-47750055 TGTTGCTCATAGATTGTGCAAGG - Intronic
974164796 4:58187679-58187701 TATTAACAAAAGAATGTGGAAGG - Intergenic
974779005 4:66527668-66527690 TAATACCCATATGATGTGGAAGG + Intergenic
975127310 4:70797358-70797380 TATTACGAAAAGACTGTGCATGG - Intronic
977088266 4:92633266-92633288 TATTTCCCCTATAATGTGAAAGG + Intronic
978977816 4:114900141-114900163 TATTATCCTTACAATGTCCATGG + Intronic
980598201 4:134983852-134983874 GATTACCAATAGATTATGCATGG + Intergenic
983518674 4:168683847-168683869 TATTACCTATTGAATGCTCAGGG + Intronic
986892751 5:12329112-12329134 GATTACTCATAGAATGTGTATGG - Intergenic
987656977 5:20819674-20819696 GAATAACCATAGAATGTGCTAGG - Intergenic
988766573 5:34384274-34384296 GAATAACCATAGAATGTGCTAGG + Intergenic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
993628829 5:90259023-90259045 TAGAACCCAAAGAATGAGCAGGG - Intergenic
994370307 5:98959944-98959966 TATAACCCTTAGAACGTGGAGGG + Intergenic
995401192 5:111743720-111743742 TATTAACCTTGGAATGTGCTTGG - Intronic
998523618 5:142822769-142822791 TATAACCAATATAATGTCCAAGG - Intronic
1000448958 5:161360569-161360591 TATTACCCTGAGAATGGACAAGG - Intronic
1000652716 5:163837145-163837167 TAACACCCATATAATGAGCAGGG + Intergenic
1001069081 5:168568538-168568560 TATTTCCCACTGCATGTGCAGGG + Intronic
1001454535 5:171850622-171850644 GATTACCCAAAGTCTGTGCAAGG - Intergenic
1003075986 6:2984099-2984121 TGTGACCCATACAATGTGTAAGG + Intergenic
1004051109 6:12080330-12080352 TTTTACCCATAGAAGATGCTAGG - Intronic
1005567315 6:27109438-27109460 TTTTATCCAAAGAATGTTCAAGG - Intergenic
1012641265 6:101619166-101619188 TATTACCCCTTGTATGTGGAAGG - Intronic
1013006129 6:106075509-106075531 TATTAACCATAAAATGTCCTTGG + Intergenic
1013666796 6:112357651-112357673 TATAACCTATAGACTGGGCATGG - Intergenic
1014665531 6:124232195-124232217 TTTTACCCAGAGAATGAGCTGGG - Intronic
1020890427 7:13871075-13871097 AATTAATCATAGAATGTGCTGGG - Intergenic
1021055595 7:16042705-16042727 GAATAACCATAGAATGTGCTGGG - Intergenic
1022593429 7:31688164-31688186 TATTACCCATAGAATGTGCATGG - Intronic
1024693701 7:51833029-51833051 TATTGCCTATAGGATGTGAATGG - Intergenic
1024829393 7:53431170-53431192 TATTACCCAAATAGTGTACACGG - Intergenic
1027977452 7:85177906-85177928 TAATACCCATGCATTGTGCAAGG + Intronic
1031113010 7:117634290-117634312 TATTATCCTTTTAATGTGCAAGG + Intronic
1031173642 7:118321652-118321674 TATTACGTTTACAATGTGCAAGG - Intergenic
1034650467 7:152686084-152686106 TATTGCCCATGGCATGAGCATGG - Intergenic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1038093287 8:24278698-24278720 TAATTCCCATAGGAAGTGCAGGG + Intergenic
1038406879 8:27328750-27328772 TGTTTCCCTGAGAATGTGCATGG - Intronic
1041563937 8:59253774-59253796 TATTAGCTATAGAATCTGTACGG + Intergenic
1041567403 8:59294852-59294874 CATTACACATAGATTGTGAAGGG - Intergenic
1044024484 8:87151581-87151603 AATTGCCCAGAGAATATGCATGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045246710 8:100448452-100448474 TCTTGCCCTGAGAATGTGCATGG + Intergenic
1045324746 8:101109828-101109850 TGTTAACCAGAGAGTGTGCAGGG + Intergenic
1048238535 8:132716927-132716949 TATTACCAAAATGATGTGCAAGG + Intronic
1048372821 8:133794591-133794613 TATTACCCAGAGCATGTCCGTGG + Intergenic
1053099202 9:35355595-35355617 TATTAAGAATAGAAAGTGCAAGG - Intronic
1056310414 9:85335138-85335160 TATTACTCAGAGCACGTGCATGG - Intergenic
1056441451 9:86625641-86625663 TATTAGCCATAAAATGCCCAGGG - Intergenic
1056499426 9:87193270-87193292 TCTGGCCAATAGAATGTGCATGG + Intergenic
1059482644 9:114603598-114603620 TTTTACCCATGGAATATCCATGG - Intergenic
1059628723 9:116096316-116096338 GATTACTCATATTATGTGCAGGG + Intergenic
1060576901 9:124704188-124704210 TATTACCCACAGAAATTGAAAGG - Intronic
1062286769 9:135776678-135776700 TATAACCCACAGAATATGCTGGG - Intronic
1193952324 X:87815138-87815160 CATTATCCATTGTATGTGCATGG + Intergenic
1196309345 X:114143870-114143892 CATATCCCATAGAATGTGCCAGG + Intergenic
1197923949 X:131626893-131626915 AGCTACCCATAGCATGTGCATGG - Intergenic
1198510831 X:137349861-137349883 TGTTTCCTACAGAATGTGCAAGG + Intergenic