ID: 1022594402

View in Genome Browser
Species Human (GRCh38)
Location 7:31698407-31698429
Sequence CTGTATACCAAGATGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022594394_1022594402 22 Left 1022594394 7:31698362-31698384 CCACTTCCAATTACCTCTATCTA 0: 1
1: 0
2: 3
3: 14
4: 168
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1022594398_1022594402 -3 Left 1022594398 7:31698387-31698409 CCTTCGTCTTCACCACTTACCTG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1022594397_1022594402 -2 Left 1022594397 7:31698386-31698408 CCCTTCGTCTTCACCACTTACCT 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1022594395_1022594402 16 Left 1022594395 7:31698368-31698390 CCAATTACCTCTATCTATCCCTT 0: 1
1: 0
2: 1
3: 25
4: 227
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1022594393_1022594402 23 Left 1022594393 7:31698361-31698383 CCCACTTCCAATTACCTCTATCT 0: 1
1: 0
2: 1
3: 19
4: 306
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1022594396_1022594402 9 Left 1022594396 7:31698375-31698397 CCTCTATCTATCCCTTCGTCTTC 0: 1
1: 0
2: 2
3: 31
4: 302
Right 1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022594402 Original CRISPR CTGTATACCAAGATGAATGG TGG Intronic
905103011 1:35541969-35541991 CTGTAAAGCTATATGAATGGAGG + Intronic
905506832 1:38486445-38486467 CTGTGAACCAAGATGTTTGGTGG - Intergenic
906938648 1:50236540-50236562 CTGTATATGAGGAGGAATGGTGG - Intergenic
907323777 1:53622109-53622131 CTGTATAGAAGGTTGAATGGTGG + Intronic
907952466 1:59196932-59196954 CTTTATACCAGGATGAATCAGGG - Intergenic
915200541 1:154224300-154224322 CTGTATATTAAGGTGAGTGGTGG + Intronic
924732885 1:246728147-246728169 CTGTGTAACAAGGTGAATGTTGG + Intronic
1063380416 10:5582038-5582060 CTGTATACCGAGAGGAATGCAGG - Intergenic
1064265081 10:13819550-13819572 CTCTATAGCAGGTTGAATGGTGG + Intronic
1065072472 10:22040154-22040176 CTGAATGCCAACATGACTGGTGG - Intergenic
1065616688 10:27534472-27534494 CTGTGTACCAATACAAATGGTGG - Intronic
1067452200 10:46388680-46388702 CTGGATCCCAAGGGGAATGGGGG + Intronic
1067585037 10:47471075-47471097 CTGGATCCCAAGGGGAATGGGGG - Intronic
1068714686 10:60175311-60175333 CTGTTAACCCCGATGAATGGAGG - Intronic
1078299347 11:10110350-10110372 CTGAATACCGAGAAAAATGGAGG - Intronic
1080589286 11:33707571-33707593 CTGTAAATCCAGATGAGTGGAGG + Intronic
1080723596 11:34872859-34872881 CTGGTTACCAAGATGGATGTCGG - Intronic
1086264598 11:84982724-84982746 TTATATACCAAGATGAAGTGAGG + Intronic
1091595532 12:1876314-1876336 CTGTATGTCAAGTTGAAGGGAGG - Intronic
1095563810 12:43596993-43597015 CTGTGTACCTAGTTGAATAGAGG - Intergenic
1100866558 12:98863829-98863851 CTTTCTACCAAGATGACTGTGGG - Intronic
1103287422 12:119814154-119814176 CTTTATTCCAAGATAAATTGAGG - Intronic
1105281652 13:18966393-18966415 TTGTATTCCATGAAGAATGGTGG + Intergenic
1107572023 13:41671742-41671764 CTGTATCCTAACATGAATGGGGG - Intronic
1108405305 13:50095060-50095082 CTAGTTACAAAGATGAATGGTGG - Intronic
1110217536 13:73039549-73039571 GTGTATACAATGCTGAATGGTGG - Intergenic
1110714558 13:78686291-78686313 CTGTTGACCAATATGAATGACGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114931604 14:27475455-27475477 CAGTTTACCAAGATAAATGTGGG + Intergenic
1116571328 14:46519811-46519833 CTGGATCCCTAAATGAATGGAGG - Intergenic
1120163951 14:81174263-81174285 CTTCATGCCAAGAAGAATGGAGG - Intergenic
1120493011 14:85200584-85200606 CTGTCTGCCAAGATTAATAGAGG + Intergenic
1121073672 14:91048678-91048700 CTGAAAAACAAGATGAATGTAGG + Intronic
1127739969 15:61893721-61893743 CAGAATGCCAAGATGTATGGGGG + Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1129311460 15:74712856-74712878 CTGTCTACCAAAAAGAAAGGGGG + Intergenic
1134145836 16:11760818-11760840 CAGTGTACCAAGATGAAATGTGG + Intronic
1134322625 16:13177434-13177456 CTGTATACAAAAATGGGTGGGGG + Intronic
1144657282 17:17044810-17044832 CTGTATTCAAAGTTGAATTGTGG + Intronic
1144858224 17:18282698-18282720 CTTAAGACCAAGAAGAATGGCGG - Exonic
1148961060 17:51393236-51393258 CTGTATGCTATGATGAATGGTGG - Intergenic
1150618051 17:66787260-66787282 CTGCATAGCAATATGAAAGGAGG - Intronic
1155944276 18:31830124-31830146 CTCTATACTGAGATGAATGAGGG + Exonic
1156274932 18:35575434-35575456 TTGGATCCCAAGATCAATGGTGG - Intergenic
1159275467 18:66215018-66215040 CTGGCTGCCAAAATGAATGGGGG - Intergenic
1163557038 19:17998770-17998792 CTGGGTACCAAGATGAATGTGGG + Exonic
1165642785 19:37403993-37404015 CTGAATATCAAGATAGATGGTGG - Intergenic
928066524 2:28170272-28170294 CTGTATATCAAAATTAATAGTGG + Intronic
931561592 2:63567319-63567341 TTGTATGCTAAGATGACTGGTGG - Intronic
932108680 2:68972933-68972955 CTGTGTACCAAGATGACTACTGG + Intergenic
935068360 2:99672444-99672466 GTGTTAACCAAGCTGAATGGTGG - Intronic
939727931 2:145746353-145746375 ATTTTTTCCAAGATGAATGGAGG - Intergenic
948168814 2:235884244-235884266 TTGTATACCAAAATCCATGGTGG + Intronic
948267330 2:236644666-236644688 CTGGAGACCAAGCTGAATGGTGG - Intergenic
948815143 2:240506701-240506723 GTGTGTACCAAGATGGATTGAGG + Intronic
1170006206 20:11672088-11672110 CTAGATACAAAGAAGAATGGTGG - Intergenic
1173185737 20:40838861-40838883 CTTAATTCCAAGATGAATGATGG + Intergenic
1174717195 20:52772096-52772118 CTGTATACAAAACTGAATTGGGG - Intergenic
1177027418 21:15936564-15936586 CTACAGACCAAAATGAATGGTGG + Intergenic
1177056145 21:16304152-16304174 CTGTATACCAACACTAATGGTGG - Intergenic
954214855 3:49118960-49118982 CTGTATACCAATAAGATGGGAGG + Intronic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956348291 3:68305261-68305283 CTGTAATCCAATATGACTGGTGG - Intronic
957119158 3:76067279-76067301 TTGTATATCAAGATCAAAGGAGG + Intronic
958519974 3:95171965-95171987 CTCAATACCAACATCAATGGGGG + Intergenic
959351923 3:105276377-105276399 CTGAATACCAAGATTATTTGAGG + Intergenic
963529137 3:146451576-146451598 TTATATACTAAGATGACTGGTGG + Intronic
967760112 3:193214447-193214469 CAGTATAGCAAGATGGGTGGGGG + Intergenic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
970369353 4:15392196-15392218 CTCGATACCTGGATGAATGGAGG - Intronic
973553380 4:52057509-52057531 CTGGGTACCCAGAGGAATGGTGG - Intronic
974808532 4:66915503-66915525 TTGTTTTCCAAGGTGAATGGTGG - Intergenic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
977753957 4:100643517-100643539 GAGTTTACCAAGATGAATAGTGG + Intronic
978252296 4:106646874-106646896 ATATATACCAAGATGAGTGGTGG + Intergenic
978817552 4:112926181-112926203 CTGCACACCAAAATGACTGGAGG - Intronic
979172080 4:117612633-117612655 CTGTATAACTATATTAATGGAGG - Intergenic
985022393 4:185705606-185705628 CTATATGCAAACATGAATGGGGG + Intronic
988525745 5:31985655-31985677 CTGTTGACCAGGATGAAGGGTGG - Intronic
990160120 5:52928717-52928739 CTGTAAAATAAAATGAATGGTGG + Intronic
994261394 5:97662987-97663009 CTGGAAACAAAGATGAATGCTGG + Intergenic
994986153 5:106936256-106936278 ATCTATGCCAAGACGAATGGAGG + Intergenic
1004548476 6:16623175-16623197 CTGTATACCACGAGACATGGAGG - Intronic
1005917914 6:30370309-30370331 GTGCAGACCGAGATGAATGGTGG + Intergenic
1009990893 6:70841732-70841754 CTGAACACAAACATGAATGGGGG - Intronic
1011507741 6:88067027-88067049 CTGTATACCAAGAACAATGAAGG - Intergenic
1012593259 6:101009341-101009363 CTTAAAACCAAGATGACTGGAGG - Intergenic
1016517462 6:144910771-144910793 AATTATGCCAAGATGAATGGTGG + Intergenic
1017333324 6:153224858-153224880 CTGTGTGCCAAGATGTCTGGGGG + Intergenic
1018436935 6:163769122-163769144 CTGTATACCAAGAAGAATAAAGG + Intergenic
1021318125 7:19176532-19176554 CTGGATATCTAGATGAATAGGGG - Intergenic
1021489220 7:21200612-21200634 GTCACTACCAAGATGAATGGCGG - Intergenic
1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG + Intronic
1022776396 7:33531989-33532011 CTGTATACCAAGAACAGTGTGGG + Intronic
1037272753 8:17147357-17147379 CTGCAGCCCAAGATGAATGATGG - Intergenic
1041504308 8:58577731-58577753 TTGTATTCCAAGTTGAAGGGGGG + Intronic
1042278214 8:67027583-67027605 GTTTTTAACAAGATGAATGGTGG - Intronic
1042666979 8:71217918-71217940 CCGTATCCCCAGATGAATTGTGG + Intronic
1044367609 8:91367832-91367854 CTGTGTACCTAAATGACTGGGGG - Intronic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1048491303 8:134896289-134896311 CTGGACACCAAGAGGAATGTGGG - Intergenic
1050078161 9:1886936-1886958 TTGAATACGTAGATGAATGGAGG - Intergenic
1052214986 9:25955402-25955424 CTGTCTAAAAAGATAAATGGAGG + Intergenic
1055611024 9:78024386-78024408 CTGGATTCCAAAAAGAATGGAGG - Intronic
1058081174 9:100702522-100702544 CTGTAAACCAGGGTGATTGGAGG - Intergenic
1059965914 9:119613498-119613520 CTGTATACCAATTATAATGGGGG - Intergenic
1061296419 9:129679271-129679293 CTGTATTCCACAAGGAATGGAGG + Intronic
1062027510 9:134347337-134347359 GTGTTGACCAAGATGAATTGCGG + Intronic
1062707278 9:137952630-137952652 CTGTCTACCCAGATGAGTAGTGG - Intronic
1062730233 9:138104428-138104450 CTGCAGACCAGCATGAATGGCGG - Intronic
1186974294 X:14883700-14883722 CTCTATACCCAGATCATTGGAGG + Intronic
1187543485 X:20223521-20223543 CAGTATACCAATATGAAAGTTGG - Intronic
1200022167 X:153221227-153221249 TTGTCTACCAAGATGAAAGTGGG + Intergenic