ID: 1022594808

View in Genome Browser
Species Human (GRCh38)
Location 7:31703074-31703096
Sequence ATGGTCCCCTTTTAGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022594808_1022594809 -7 Left 1022594808 7:31703074-31703096 CCATAAATCTAAAAGGGGACCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1022594809 7:31703090-31703112 GGACCATAAATATGTCTCCCAGG No data
1022594808_1022594810 -6 Left 1022594808 7:31703074-31703096 CCATAAATCTAAAAGGGGACCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1022594810 7:31703091-31703113 GACCATAAATATGTCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022594808 Original CRISPR ATGGTCCCCTTTTAGATTTA TGG (reversed) Intronic
900310554 1:2031362-2031384 ATGGTCCCCTCTTGGATGTGAGG + Intergenic
901750530 1:11404500-11404522 ATAATCCCCATTTAGATTGAAGG + Intergenic
903783365 1:25837839-25837861 ATGATGCTCTTTTATATTTAAGG + Intronic
905638183 1:39569995-39570017 ATGGTTTCATTTTAGATTTGTGG - Exonic
907087232 1:51686740-51686762 ATGCTCCCCGTATGGATTTAAGG + Intronic
907227866 1:52966364-52966386 ATGTTCCCCACTTAGATCTATGG + Intronic
907873643 1:58465684-58465706 ATGGATCCATTTTTGATTTAGGG - Intronic
908499929 1:64733032-64733054 AGGGGCCCCTGTTAGATTTGGGG - Intergenic
909021272 1:70433887-70433909 ATGGTCACCTTTTATATTAAGGG + Exonic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG + Intergenic
913426559 1:118737921-118737943 ATGCTCCCAATTTAGAATTAAGG + Intergenic
913549862 1:119906931-119906953 ATGGTACCCACTTAGATTGAGGG - Intergenic
915893607 1:159793863-159793885 ATGGTGCCATTTTCGATTTTTGG - Intergenic
918160847 1:181897930-181897952 ATGGTACCCATTCAGATTGAGGG + Intergenic
920080718 1:203371107-203371129 TTGTTTCCCTTTCAGATTTAGGG + Intergenic
921610686 1:217209123-217209145 ATAGTCACCTTTTAGTTTTGTGG + Intergenic
924218155 1:241846855-241846877 ATGGACACCTTTTTGATTTTGGG + Intergenic
1068053433 10:51981674-51981696 GTGGTCCCCTGTTAGTCTTATGG + Intronic
1070200299 10:74197905-74197927 TTGGTCCCCTCTCAGTTTTAAGG - Intronic
1074034036 10:109720025-109720047 ATGGTGCCCTCCCAGATTTAGGG - Intergenic
1075156285 10:119978634-119978656 ATAGTCCCCTTTTTGTTTTAAGG - Intergenic
1077005104 11:351313-351335 AGGGTCCCTTTTAAGATTTAGGG - Intergenic
1077944858 11:6885719-6885741 ATGGAACCCTTTTAGATCTTTGG - Intergenic
1081559384 11:44199018-44199040 ATGCTTTCTTTTTAGATTTAGGG + Intronic
1083833773 11:65250794-65250816 ATGAACCACTTTTAGATTTAGGG - Intergenic
1084070579 11:66731069-66731091 ATGGTGCCATTTTACATGTAAGG - Intergenic
1086285430 11:85243815-85243837 ATTGTCTCATTTTAGAATTAAGG - Intronic
1088978986 11:114844297-114844319 ATGGTCCCCTAGTAAATTTGTGG - Intergenic
1089478855 11:118789785-118789807 ATAGTCTCATTTTGGATTTAAGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091328448 11:134711343-134711365 ATGGTCCCCATTTAGAGATCAGG - Intergenic
1091899212 12:4130673-4130695 ATGTTTCACTTTTAAATTTAGGG - Intergenic
1093285535 12:17255947-17255969 ATTGTCCCCTTTTACATTTTTGG + Intergenic
1093307836 12:17541633-17541655 AGAGTCCCTTTTAAGATTTAGGG - Intergenic
1094120971 12:26973822-26973844 ATGGTGCCCTTATTGATATATGG - Exonic
1094275513 12:28670204-28670226 GAGGTCCACTGTTAGATTTATGG - Intergenic
1094684032 12:32693177-32693199 ATAGTCACATTTTAAATTTATGG + Intronic
1094715425 12:33009821-33009843 CTTTTCCCCTTTTATATTTATGG + Intergenic
1095590318 12:43896000-43896022 ATGGTGCCCATTCAGATTGAGGG + Intronic
1097564344 12:61249946-61249968 ATGGTGCCCTCTCAGATTAATGG + Intergenic
1097601736 12:61701289-61701311 GTGGTCACCTTTTATATTCAGGG - Intergenic
1099082630 12:78204920-78204942 GTGGTCAACTTTTAGATGTATGG + Exonic
1099344845 12:81486201-81486223 ATGATCCCATTTTACATGTAGGG + Intronic
1100683851 12:96963035-96963057 AGGGGCTCCTTTTAGATCTAAGG + Intergenic
1102737508 12:115175761-115175783 ATGGTACCCATTCAGATTGAGGG + Intergenic
1102940451 12:116936914-116936936 ATGGTCCCTTTTTAAACGTAGGG - Intronic
1109969367 13:69745577-69745599 ATGGTCCATTTTTATATTTGTGG - Intronic
1109984138 13:69953997-69954019 ATTTTCCCTTTTTACATTTAAGG + Intronic
1110077691 13:71269639-71269661 ATGGTCCCTTTTGGGAGTTATGG + Intergenic
1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG + Intergenic
1112308328 13:98295429-98295451 ATGCTAGCCATTTAGATTTAAGG + Intronic
1112583392 13:100695643-100695665 AGGGTTCCCTTTTAGATTCCCGG + Intergenic
1112838538 13:103546957-103546979 ATGCTCCCCTTTCACTTTTAAGG - Intergenic
1116615218 14:47127880-47127902 ATCTTCCCCTTTTGGCTTTAAGG + Intronic
1116924572 14:50620947-50620969 ATTGTCCCCTTTTATCTTGAGGG + Intronic
1120394925 14:83956634-83956656 ATGGTCACCTGTTAGATGGAAGG + Intergenic
1124198987 15:27660368-27660390 ATGGACAACTTTTAGATTGAGGG + Intergenic
1125104309 15:35952879-35952901 ATGGCCCCATTTTAGATGGAAGG + Intergenic
1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG + Intergenic
1134272760 16:12747921-12747943 GTGTTCCTCTTTTAGGTTTATGG - Intronic
1135627177 16:24006107-24006129 ATGGTGCACTTTCAGATGTAGGG - Intronic
1139224489 16:65221056-65221078 ATGCTCCCATTTTAATTTTATGG - Intergenic
1153757239 18:8296654-8296676 CTGTTTTCCTTTTAGATTTAAGG + Intronic
1156850108 18:41716153-41716175 TTGGTCCCTTTTAAGAATTATGG - Intergenic
1158015857 18:52782983-52783005 ATGGTGCCCTGTTAGAGTAAAGG + Intronic
1164136976 19:22425083-22425105 ATGGTCTCATTTAAGAGTTAGGG + Intronic
1168526493 19:57092564-57092586 AAGGTCCCCTGCTAGTTTTAAGG - Intergenic
929160085 2:38822928-38822950 ATGGTCCCCTTAGAGACCTATGG + Intronic
929262031 2:39876535-39876557 ATAGTCCCATTTTATAGTTAAGG - Intergenic
930391007 2:50761739-50761761 ATGGTACCCTTCCAGATTGAGGG - Intronic
930632831 2:53772515-53772537 GTGGTCCCCTTTGACATTAACGG + Intronic
930834321 2:55776994-55777016 ATGGTCTACTTTTAGCTTTGAGG - Intergenic
930967386 2:57346350-57346372 ATGGACCCCTTTTATGGTTAGGG - Intergenic
935396048 2:102610399-102610421 CTGGTCCCATTTTAAATTCATGG + Intergenic
938807910 2:134823918-134823940 ATGGTCCCTTTTACCATTTAGGG + Intergenic
941698110 2:168575175-168575197 ATGGCCCCATTTTAAATTCAAGG - Intronic
942719834 2:178939188-178939210 ATGGGCCCCTTTTAAACGTAAGG - Intronic
945352369 2:208796280-208796302 ATGGACCCATTTTAGACTTCTGG + Intronic
946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG + Intergenic
947128925 2:226901730-226901752 TTAGTCCCCTATTAGATATATGG - Intronic
1169256262 20:4102112-4102134 ATGGTCCAGTTCTAGATTAAAGG + Intergenic
1169722280 20:8691836-8691858 ATGGTCACTTTTTGGATTTGGGG + Intronic
1170856515 20:20061224-20061246 CTTGTCCTCTTTTAGATTCAGGG - Intronic
1177382560 21:20364522-20364544 ATGGTCTGCTCTAAGATTTATGG - Intergenic
1178435942 21:32558576-32558598 AGGGTCCCTTTTAAGATTTAAGG - Intergenic
1182045250 22:27269140-27269162 ATGGTCCCATTTTACAGGTAGGG - Intergenic
949165819 3:939529-939551 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
951840720 3:27031290-27031312 ATGGAATCCTTTTAGAATTATGG - Intergenic
952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG + Intronic
953286864 3:41618781-41618803 ATTGAACCCTTTTACATTTAAGG - Intronic
957844839 3:85718243-85718265 ATGTTCCAGTTATAGATTTAGGG + Intronic
959494569 3:107035274-107035296 ATGGTCACATTTTAAATTCATGG - Intergenic
960918482 3:122722062-122722084 ATGGTTTGCTTTTTGATTTACGG - Intronic
961746362 3:129065903-129065925 ATGGTGCCCATGTAGATTGAGGG - Intergenic
963437629 3:145291134-145291156 AAGGTTCCCTTTGGGATTTAGGG - Intergenic
964550398 3:157878830-157878852 ATGGTCCCATGTTATCTTTAGGG + Intergenic
964589515 3:158344614-158344636 AGGGTGCCCTTTTAGCATTAGGG + Intronic
965461062 3:168963865-168963887 ATGGTCCCCACTCAGATTAAGGG + Intergenic
965770083 3:172172803-172172825 ATGGTCACCATTTAAATATAAGG + Intronic
966187926 3:177244865-177244887 ATGGTCCCTTCCTAGATTCAAGG + Intergenic
966214616 3:177489762-177489784 ATAATCCACTTTTAGATTAATGG - Intergenic
970542491 4:17094028-17094050 ATGTTGCCCTTTCAGTTTTAGGG - Intergenic
971729844 4:30362986-30363008 ATGGTAACATTCTAGATTTATGG + Intergenic
973873610 4:55191646-55191668 ATGTATCCCTTTTACATTTAAGG - Intergenic
974751928 4:66153536-66153558 ATGGTCCCCTGTTAGAATGGTGG + Intergenic
980255875 4:130380844-130380866 ATGGTACCCTCTCAGATTGAGGG - Intergenic
984156267 4:176199053-176199075 ATGGTCCCATTTTAGTTTTTCGG + Intergenic
988425977 5:31065063-31065085 ATGGTCACCTTTAACATTAATGG - Intergenic
992623109 5:78612901-78612923 ATGGTCCCCTAATAGTTTGAAGG + Intronic
994150310 5:96440211-96440233 ATTTTCCCCTTATAGAGTTAAGG - Intergenic
994613964 5:102079858-102079880 ATGTTCTGCTTTTAGCTTTATGG - Intergenic
997395669 5:133557894-133557916 AGGGTCCCCTTTGACTTTTAAGG - Intronic
997626689 5:135335974-135335996 CTGGTCCCATTTTACAGTTAAGG + Intronic
998912219 5:146972298-146972320 ATGTTCACCTTGTGGATTTAAGG + Intronic
1000204238 5:159042423-159042445 AGGGTCAGCTTTTAGATATATGG - Intronic
1000960787 5:167598411-167598433 ATAGTCCCCCTTGAGATTTCAGG - Intronic
1006653393 6:35569602-35569624 ATGGACCCATTTTACAGTTATGG + Intergenic
1009326698 6:62358984-62359006 ATTGTCACCTTTTTCATTTAGGG + Intergenic
1009806792 6:68609423-68609445 ATGGTTCCCGTGCAGATTTAAGG - Intergenic
1016430741 6:143982661-143982683 GTGGTCACCTTCTGGATTTATGG + Intronic
1016509269 6:144822637-144822659 TTGGTCCTCTTTTTGATTTGTGG + Intronic
1017348725 6:153415085-153415107 AGAGTCCCTTTTAAGATTTAGGG - Intergenic
1017802117 6:157906589-157906611 AAGGTACCCTTTCAGATATATGG + Intronic
1017812659 6:157995235-157995257 ATCTTCTCCTTTTAGATTTCAGG + Intronic
1018190771 6:161307513-161307535 ATGGTGCCCATTTGGATTGAGGG + Intergenic
1018780984 6:167065134-167065156 ATGGTGCCCATTCAGATTGAGGG + Intergenic
1021859336 7:24890733-24890755 ATGGTCATCTTTTATATTTAGGG - Intronic
1022056970 7:26747110-26747132 TTAGTCCTCTTTTAGAGTTACGG - Intronic
1022229895 7:28404633-28404655 ATGGTCCCATATTTGGTTTAAGG - Intronic
1022594808 7:31703074-31703096 ATGGTCCCCTTTTAGATTTATGG - Intronic
1030371016 7:108699446-108699468 AGGGTCCTCTTTTAGCTCTATGG + Intergenic
1030794512 7:113770726-113770748 ATGGTACCCTTTAAGTTATACGG - Intergenic
1031014967 7:116563945-116563967 ATGGTCCCATTTTACAAATAAGG + Intergenic
1036116575 8:5966406-5966428 ATGGTCCCCGTCTACCTTTATGG - Intergenic
1037185810 8:16062221-16062243 ATGATGCTCTTTTACATTTAAGG - Intergenic
1037875158 8:22541799-22541821 ATGGTCCCCTTGTGAATTGAAGG + Intergenic
1041412455 8:57571835-57571857 ATGCTGCCATTTTAGATATATGG + Intergenic
1044106553 8:88214956-88214978 AGGGTACCTTTTCAGATTTAAGG - Intronic
1044482499 8:92708480-92708502 ATAGTCCAGTTTTAGATTAATGG - Intergenic
1045116455 8:98988168-98988190 ATAGTCCTCTTTTAGATTTTTGG + Intergenic
1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG + Intronic
1048337276 8:133512423-133512445 ATGGTGCCCATTCAGATTGAGGG + Intronic
1050438491 9:5634614-5634636 TTAGCCCCCTTTTAGATGTATGG + Intronic
1050658227 9:7852999-7853021 ATGGTGCCCTCTCAGATTGAGGG + Intronic
1052520956 9:29547980-29548002 AGAGTCCCTTTTAAGATTTAGGG + Intergenic
1056288729 9:85119089-85119111 TTGGCACCCTTTTACATTTAGGG + Intergenic
1056321131 9:85435567-85435589 ATGTAGCCCTTTTACATTTAAGG - Intergenic
1058648405 9:107152295-107152317 AGGGTCCCCTCTTAGATGCAGGG - Intergenic
1188347540 X:29085494-29085516 TTGGTCCCATTTTACAGTTAGGG + Intronic
1192030925 X:67511365-67511387 ATGGAGCCCATTTACATTTAAGG - Intergenic
1192730716 X:73800391-73800413 AGAGTCCCTTTTAAGATTTAGGG - Intergenic
1193067815 X:77277893-77277915 ATGGTCCACTGTTAGCTTAATGG - Intergenic
1193578169 X:83229827-83229849 ATGGTCACCTGTTAGACTGAGGG + Intergenic
1194233163 X:91348837-91348859 ATGGTCCCCACCTAGATTGAGGG - Intergenic
1195728327 X:107939814-107939836 ATTGTCCCCTTTCAGAGATAAGG - Intergenic
1196132008 X:112167084-112167106 ATGGTCCATTTTTTGCTTTAAGG - Intergenic
1196927440 X:120647488-120647510 ATCCTCCCGTTTTATATTTAAGG + Intergenic
1197159038 X:123303034-123303056 ATGGTCTCCTATTACTTTTAAGG + Intronic
1198839272 X:140839384-140839406 ATGATCCCATTTTTGATTTCTGG - Intergenic