ID: 1022601446

View in Genome Browser
Species Human (GRCh38)
Location 7:31764067-31764089
Sequence CATTTTAAGCAAAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 1, 1: 0, 2: 10, 3: 74, 4: 911}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022601442_1022601446 9 Left 1022601442 7:31764035-31764057 CCTGAGGAAGCCACTTTGCTGAA 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1022601446 7:31764067-31764089 CATTTTAAGCAAAGGAAAAATGG 0: 1
1: 0
2: 10
3: 74
4: 911
1022601443_1022601446 -1 Left 1022601443 7:31764045-31764067 CCACTTTGCTGAAACTATGTGCC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1022601446 7:31764067-31764089 CATTTTAAGCAAAGGAAAAATGG 0: 1
1: 0
2: 10
3: 74
4: 911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022601446 Original CRISPR CATTTTAAGCAAAGGAAAAA TGG Intronic
900876558 1:5347010-5347032 GGTTTTAAAAAAAGGAAAAACGG - Intergenic
901112970 1:6813947-6813969 AAGTTTATGGAAAGGAAAAATGG - Intronic
903173336 1:21566902-21566924 CATTTTATGGATAGGAAAACTGG + Intronic
903432916 1:23322237-23322259 CATCTTAAGAAAAAAAAAAAAGG - Intronic
903715311 1:25361407-25361429 CCATTGAAGGAAAGGAAAAAAGG + Exonic
903730868 1:25494380-25494402 TAGTATAAGCAAAGGAAAGAAGG + Intronic
903797794 1:25943114-25943136 CACCTTCAGCAAAGGAAAAGTGG + Intergenic
904135188 1:28306881-28306903 CATTTTAAGATAAGGAAACTGGG - Intergenic
904764453 1:32833159-32833181 AACTTTAAGCAAAGGCTAAACGG - Intronic
905098298 1:35494923-35494945 GATTTTCAACAAAGGTAAAACGG + Intronic
905205118 1:36339082-36339104 AAATTTAAGCAAAGGAAGGAAGG + Intergenic
905532515 1:38693321-38693343 CATTTTCTGAAAAGGACAAATGG - Intergenic
905756865 1:40517877-40517899 AGTTTTAAGAACAGGAAAAAGGG + Intergenic
906722244 1:48017206-48017228 CATTTAAAGTAAAGTAAGAAGGG + Intergenic
907301045 1:53486490-53486512 CCTGTTAAACAAAGGAAGAAAGG - Intergenic
907690134 1:56656313-56656335 CATTTTACAGAAAAGAAAAATGG - Intronic
907760462 1:57353613-57353635 AATTTTAAGCAACAGAAGAAAGG + Intronic
907791114 1:57664805-57664827 CATTTTAAGCAGAAAAAAATAGG + Intronic
907884886 1:58583860-58583882 CATTTTAAGCAAACAAAATATGG - Intergenic
907957527 1:59244395-59244417 CCTTTTAAGAAAAGGGAAATTGG - Intergenic
908130146 1:61067238-61067260 AATTTTAAAAAAAGTAAAAATGG + Intronic
908414260 1:63897541-63897563 CATTTTAGGAAAAAGAAAGAAGG - Intronic
908443636 1:64179923-64179945 CATTTCCAGCACAGAAAAAAAGG - Exonic
908685560 1:66715101-66715123 CATCTTAAGGAAATTAAAAAAGG + Intronic
908906294 1:69014885-69014907 CAATTTAAGGAAGAGAAAAATGG - Intergenic
909082831 1:71134514-71134536 CATTTTAAACAACAGAAAACAGG + Intergenic
909533113 1:76702948-76702970 CAATTTAAGAAAAGGGGAAAAGG + Intergenic
909568757 1:77084510-77084532 CATTTTAAGCAAGGTACAGATGG - Intergenic
910737747 1:90480305-90480327 CATTTTTAGCAAGTGAAAATTGG + Intergenic
910829974 1:91450995-91451017 CATTTTTAGAAAAGAGAAAAGGG - Intergenic
910897451 1:92083717-92083739 GAATTTAAGGAAAGGAAAATTGG + Intronic
911204450 1:95078331-95078353 CCTTTTAAGCAATTGAAATATGG + Intergenic
911519165 1:98908232-98908254 CTTTAGGAGCAAAGGAAAAATGG + Intronic
911550730 1:99276782-99276804 CATTATCAGCTAAAGAAAAATGG + Intronic
911686436 1:100782089-100782111 CATTTTAAACAGAGCAAGAATGG - Intergenic
911702088 1:100965646-100965668 CATTTTAAAAAAAGGAAAGGAGG - Intronic
911840914 1:102680793-102680815 CCTTTTCAACAAAGGAAAGAAGG - Intergenic
912138207 1:106687764-106687786 GATTTTTAGAAAAGGAATAAGGG - Intergenic
912167069 1:107054678-107054700 CATTTTGAGGAAAGAAAGAATGG + Intergenic
912702191 1:111886741-111886763 CATTTTAACCAAAAGGAGAAAGG + Intronic
912773920 1:112491545-112491567 CATTTCAGGCCAAGGGAAAATGG + Intronic
913047134 1:115083899-115083921 AATTCTAATCAAAGGCAAAATGG + Intronic
913355443 1:117916349-117916371 CATGGTAAGGAAAGGAAAAGGGG + Intronic
913563059 1:120042575-120042597 CAGTTCAAGCAAAGGGACAAAGG + Intronic
913635064 1:120751015-120751037 CAGTTCAAGCAAAGGGACAAAGG - Intergenic
913996724 1:143656785-143656807 CATCTTAAACAACAGAAAAAAGG + Intergenic
914237817 1:145828139-145828161 CATTGTAAGCAAAGCAAGAGAGG + Intronic
914261697 1:146004434-146004456 AATTGTTAGCAAAGGAGAAAAGG - Intergenic
914283655 1:146201937-146201959 CAGTTCAAGCAAAGGGACAAAGG + Intronic
914471765 1:147985713-147985735 AAGTTTAAAAAAAGGAAAAAGGG - Intronic
914544686 1:148652673-148652695 CAGTTCAAGCAAAGGGACAAAGG + Intronic
914621941 1:149418336-149418358 CAGTTCAAGCAAAGGGACAAAGG - Intergenic
914691905 1:150036620-150036642 AAATTTCAGCAACGGAAAAATGG - Intergenic
915182722 1:154077072-154077094 CATTCAAAGTAAAAGAAAAAGGG + Intronic
916444581 1:164860526-164860548 CATCATGAGCAAAGGTAAAAAGG - Intronic
916672512 1:167035721-167035743 CATTTTAAGGAAAGAAGAGAAGG - Intergenic
916772556 1:167926449-167926471 CATTTTTACGAAGGGAAAAAGGG + Intronic
916883651 1:169046592-169046614 CAATGTAGGCAAAGGTAAAAAGG + Intergenic
917071996 1:171161326-171161348 CATTTTAAGCAAATTGTAAAAGG - Exonic
918222820 1:182451495-182451517 CATTTGAAGCAATGGGAATATGG + Intronic
918498579 1:185167583-185167605 GATTTTCAGCAGAGGAGAAATGG - Intronic
918879126 1:190091570-190091592 CCTTTTAAGCAAAGCTAACAAGG + Intergenic
919111974 1:193231654-193231676 CTTTTTAACCAAATGTAAAATGG + Intronic
919116765 1:193289571-193289593 CATTATTACCAAAGGAAAAGGGG + Intergenic
919344330 1:196355411-196355433 CATTTTCAGGATAAGAAAAATGG + Intronic
920674998 1:208032444-208032466 CATATTAGGCAAAGCTAAAATGG + Intronic
920771249 1:208888245-208888267 CAATTTAAGAAAAAGAACAATGG + Intergenic
921449183 1:215283561-215283583 CCCTTTAACCAAAAGAAAAAAGG - Intergenic
921493527 1:215808400-215808422 CATTTTACACATAGGAAAAATGG - Intronic
921967475 1:221105674-221105696 CATTTTAAGCTACAGAAATATGG + Intergenic
921986274 1:221316268-221316290 CATTTTACAGAAAAGAAAAACGG - Intergenic
922949524 1:229547068-229547090 CCAGTTAAGGAAAGGAAAAAAGG + Intronic
923271181 1:232356512-232356534 AATTTTATCCATAGGAAAAATGG - Intergenic
923321960 1:232843314-232843336 CATTCTAAATAAAGGAACAATGG + Intergenic
923431716 1:233928541-233928563 CATTTTACGGAAAAGGAAAAAGG - Intronic
923833330 1:237581947-237581969 TATTTTAAGGAAATGAAAACAGG - Intronic
924046598 1:240038294-240038316 CTTTTTAAGTAAAAGAAAAGGGG - Intronic
924072215 1:240292630-240292652 GATTTTAAGGAAGGGAGAAATGG + Intronic
924301216 1:242639955-242639977 CATTTTATGCAAACCAAAAAAGG - Intergenic
924481301 1:244437136-244437158 AATTTTAAGCAAATGGAACATGG + Intronic
924732135 1:246722075-246722097 CCTTTAAAGCAACGCAAAAATGG - Intergenic
1063468490 10:6264643-6264665 CATTTTGAGTAAAGGGAACAAGG - Intergenic
1063498795 10:6535031-6535053 CATTATAAAGAAGGGAAAAATGG + Intronic
1063730154 10:8687344-8687366 CATGTTATGCATAGGAAGAAAGG + Intergenic
1063756357 10:9014297-9014319 CATTTTAACTAAAAGACAAATGG - Intergenic
1065120078 10:22520797-22520819 CATTTTCAGCAAAGTAACACAGG - Intergenic
1065455781 10:25905287-25905309 CCTTTCAAGCCAAGGAAAAGGGG - Intergenic
1065817390 10:29494433-29494455 CATTTTAATCAAGAGATAAAAGG + Intronic
1065954482 10:30681418-30681440 CGTATTAAGCAATAGAAAAAAGG - Intergenic
1065955467 10:30690026-30690048 CATTTTAATCAAGAGATAAAAGG - Intergenic
1066224548 10:33369553-33369575 CCTTTAAAGCAATGCAAAAATGG - Intergenic
1066373843 10:34839686-34839708 CACATAAAACAAAGGAAAAAGGG - Intergenic
1066530222 10:36329410-36329432 AATTTAAAATAAAGGAAAAATGG - Intergenic
1067128228 10:43538568-43538590 CATCTTAAACAAAAGAAAACAGG - Intergenic
1067956477 10:50796560-50796582 AAATTGAAGCAAAAGAAAAATGG - Intronic
1068014686 10:51501142-51501164 CATATTAAGCAAAAATAAAAGGG - Intronic
1068138194 10:52971895-52971917 CATTTTCAGCTAAAGACAAATGG + Intergenic
1068269907 10:54707858-54707880 CATTTTAAGAAGGGGAATAAAGG + Intronic
1068460786 10:57325461-57325483 AATTTTAAACATAGGCAAAAGGG - Intergenic
1068586425 10:58804868-58804890 CATTTTCAGCCAAGGAAATCAGG - Intronic
1068826181 10:61442298-61442320 CATTTTTAGAAAGAGAAAAATGG - Intronic
1069317923 10:67130866-67130888 CAATTCAAGCAGAGGAAGAAAGG - Intronic
1069848966 10:71392775-71392797 CATTTTCAGAAATGGAAACAAGG + Intergenic
1070577875 10:77693476-77693498 CATTTAAAGCCATGGAAGAATGG - Intergenic
1070606572 10:77902468-77902490 CATTGTAAGTACAGAAAAAATGG + Intronic
1071133094 10:82418444-82418466 CAGTTTATGCAAATGAAAAGAGG + Intronic
1071437479 10:85660673-85660695 CCTCTTAAGCAGAGGAAACAAGG + Intronic
1071675647 10:87653580-87653602 CATTTTAAAGAAAGGAAAGAAGG - Intergenic
1071795284 10:88998452-88998474 CATTTTAAGAAGAGGAAATTTGG - Intronic
1072142917 10:92605793-92605815 GATTTTAAGAATAGGAGAAATGG + Intronic
1072224398 10:93355034-93355056 AATTTTAACTATAGGAAAAAAGG - Intronic
1072260569 10:93667183-93667205 TATTTTAAGCAATGGAAATAAGG - Intergenic
1072280175 10:93858692-93858714 CATTTTAAGAAAATGGAACATGG - Intergenic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1072659300 10:97353386-97353408 TATTTCAAAAAAAGGAAAAATGG - Intergenic
1073456908 10:103642836-103642858 CATTTTTAGCAAAGAGAGAAAGG - Intronic
1073809777 10:107139902-107139924 CAATTTCACCAAAGGCAAAACGG - Intronic
1073933479 10:108602215-108602237 CATTTTAATCAAAGGAATGCTGG - Intergenic
1074490739 10:113937303-113937325 CTTTTTAAACAAACAAAAAAGGG - Intergenic
1075439579 10:122468886-122468908 CATCTTAAGGAAGGAAAAAAAGG + Intronic
1075565468 10:123500509-123500531 CAATTTTAGGAAAAGAAAAAAGG - Intergenic
1075611052 10:123854975-123854997 CAATGTAACCAAAGTAAAAAGGG - Intronic
1075897315 10:126008354-126008376 CATTTTAAGAAAAAGAAATTGGG + Intronic
1075965263 10:126605614-126605636 CCTTTTTAGCCAAGGAGAAAAGG + Intronic
1076006327 10:126950540-126950562 CCTTTGAAGCAAAGGGAAATCGG + Intronic
1076310485 10:129502755-129502777 GATTTTAAGGAAAAGAATAAAGG - Intronic
1077492461 11:2868251-2868273 TATTTGAATCAAAGGAAAAAGGG - Intergenic
1077594505 11:3520111-3520133 CATCTTAAACAAAAGAAAACAGG - Intergenic
1077874133 11:6289379-6289401 AGTTTTGAGCAAAGGAAGAAAGG + Intergenic
1078003442 11:7515174-7515196 GAATTTAAGCAAAGTACAAATGG - Intronic
1078595054 11:12678911-12678933 TATTTTAGTCAAAGTAAAAATGG + Intronic
1079731923 11:23943875-23943897 CATCTTAAGAAAAGAAGAAAAGG - Intergenic
1079845376 11:25460454-25460476 CTTTTTAACCAAATGTAAAATGG + Intergenic
1080155457 11:29105694-29105716 CATCTTAAACAACAGAAAAAAGG - Intergenic
1080300790 11:30782956-30782978 CATTTTAAGCAGAGAACAGAGGG + Intergenic
1080476143 11:32593134-32593156 TATTTTTAGAAAATGAAAAAAGG + Intronic
1081163413 11:39780303-39780325 TATTTTAAGTAGAGGAAATAAGG + Intergenic
1081225052 11:40511338-40511360 CATTTTATGACAAAGAAAAATGG + Intronic
1081258920 11:40934011-40934033 GATTTTTAACAAAGGAAAAAAGG + Intronic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1082143304 11:48634894-48634916 CATCTTAAGCAACAGAAAACAGG + Intergenic
1082282162 11:50281596-50281618 CATTTTAAACAACAGAAAACAGG - Intergenic
1082630854 11:55540384-55540406 CATTCTAGGCAAAAGAGAAAAGG + Intergenic
1082949175 11:58791838-58791860 GATTTTAAAAAAAGAAAAAAAGG - Intergenic
1083809197 11:65093765-65093787 AATCTTAAGAAAATGAAAAAGGG - Intronic
1084139885 11:67219496-67219518 CATTTTAACTGAAAGAAAAATGG - Intronic
1084699095 11:70774771-70774793 CAATTTAAGAAAAGAAAAAAAGG + Intronic
1084851125 11:71941813-71941835 CATAATTAGCAAAGGAAAAATGG + Intronic
1084887435 11:72220284-72220306 CATTTTGAGCAAAGGAAGAGAGG - Intronic
1085962155 11:81474196-81474218 AATTTTTAGTAAAGGAAACATGG - Intergenic
1087059652 11:93965143-93965165 TATTTAAAGCAATGCAAAAATGG - Intergenic
1087635287 11:100695186-100695208 CCCTTGAAGCAAAGGAAAAGAGG + Intronic
1087853308 11:103058964-103058986 CATTTTAATAAAAAAAAAAAAGG - Intergenic
1087958634 11:104320672-104320694 CATATTTAGCAGAGAAAAAAGGG + Intergenic
1088670888 11:112139466-112139488 CCTTTTGAGCAACTGAAAAATGG + Intronic
1089331713 11:117693668-117693690 CATTTTAAAAAAAGAAAAACAGG + Intronic
1089798954 11:121007799-121007821 CATTTTAACAGAAGGAGAAAGGG + Intergenic
1089807533 11:121104845-121104867 AAATTTAAAGAAAGGAAAAAAGG + Intronic
1091912541 12:4243636-4243658 CTTTTTGACCAAAGGAGAAATGG + Intergenic
1091922400 12:4316010-4316032 CTTTTTAAAAAAATGAAAAATGG - Intergenic
1091996924 12:5001080-5001102 CATTTTCAGCATGGGGAAAATGG - Intergenic
1092481483 12:8863075-8863097 CATTTTAAGTAGAATAAAAATGG - Intronic
1092695661 12:11168858-11168880 CACTTTATCCAAAGGAAAAATGG + Intronic
1092738272 12:11604708-11604730 CAGGCTAAGCAAAGGAAAAAAGG + Intergenic
1093088167 12:14889950-14889972 CAAATTAAGGAAAGGAAAGAAGG - Intronic
1093237188 12:16625420-16625442 TATTTTCAGTAAAAGAAAAATGG + Intergenic
1093486327 12:19656851-19656873 TATTATAAGCAAAGGAAATTTGG - Intronic
1093658778 12:21728647-21728669 TATTTTAGGTAAAGGAACAAAGG + Intronic
1093661497 12:21762780-21762802 CATTTTAAGAAAAATAAAAAGGG + Intergenic
1093913559 12:24774710-24774732 CATTTTAATCATAGGAAATATGG - Intergenic
1093957207 12:25234437-25234459 CATTTTAAGTAATGATAAAATGG - Intronic
1093972158 12:25385412-25385434 GATTTTAGGCAAAGGCCAAAGGG - Intergenic
1094079902 12:26522582-26522604 CCATTTAACCAAAGGGAAAATGG - Intronic
1094160620 12:27386140-27386162 TTTTTTAATTAAAGGAAAAATGG - Intronic
1094298801 12:28937949-28937971 CTTTATAAACAAAGGAAAAGAGG - Intergenic
1094316730 12:29144404-29144426 CATTTTGATTAATGGAAAAAAGG - Intergenic
1094603251 12:31929108-31929130 CCTTTTTAACAAAGGAAAGAGGG + Intergenic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095383892 12:41627815-41627837 CTTTTGAAGAAAAGGAGAAAAGG + Intergenic
1095432392 12:42147892-42147914 CATTTTAAAAAAATGAAAATGGG - Intergenic
1096364866 12:51020329-51020351 CATTTTAATAAGAGGAAAACAGG - Intronic
1096454679 12:51775142-51775164 CATTTTAAAGAAAGGATGAATGG + Intronic
1096853983 12:54465462-54465484 CACTTTTAGAAAAGGAAAAGAGG - Intronic
1097625941 12:62000791-62000813 CATGTTAAGCAAAAGAAATAAGG + Intronic
1097822999 12:64146400-64146422 AATTTAAAGAAAAGGAAAAGAGG + Exonic
1098086584 12:66851089-66851111 TGATTTAAGCAAAGGAAAAAGGG - Intergenic
1098600390 12:72324409-72324431 GATTTACAGCAAAGGAGAAATGG + Intronic
1098690138 12:73477051-73477073 TATTATAATCTAAGGAAAAAAGG + Intergenic
1098835254 12:75416801-75416823 TATTTGTATCAAAGGAAAAATGG - Intronic
1099150036 12:79099020-79099042 CATTGTAAGCACAGGAAAGGAGG + Intronic
1099221577 12:79920897-79920919 CGTTATAAGCAAAAGAAAACAGG + Intronic
1099246189 12:80196218-80196240 CAAATTAAGCAATGGAGAAAAGG - Intergenic
1099378255 12:81920893-81920915 AATTTTAATCAAATAAAAAAAGG + Intergenic
1099618205 12:84966164-84966186 CATTTTCAGCAAAAGAACACGGG - Intergenic
1099716355 12:86297746-86297768 AATTTTAACAAAAGAAAAAAAGG + Intronic
1099837969 12:87931834-87931856 GAATTCAAGCAAAGAAAAAAAGG - Intergenic
1100415186 12:94365149-94365171 ATTTTTAAGCAAGGGAAAAAAGG + Intronic
1100450813 12:94704715-94704737 CATTTCTAGCTAAAGAAAAAGGG + Intergenic
1100735616 12:97526290-97526312 CATTTTAAGGAAAAGAAGAATGG - Intergenic
1100789561 12:98115561-98115583 CAGTTTATCCAAAGGAGAAATGG - Intergenic
1101297923 12:103444827-103444849 CATTTAAAGAAAAGAAGAAAGGG - Intronic
1101732144 12:107435709-107435731 CATTTAAAGCAAGGGAAAGTTGG - Intronic
1102755723 12:115338338-115338360 AATTCTAAGCAAGGGAATAATGG + Intergenic
1102826854 12:115954089-115954111 AATTCTAATCAAAGGAAAGAGGG + Exonic
1103055877 12:117819901-117819923 CATTTTTAACAAAGCAGAAATGG - Intronic
1103322928 12:120102181-120102203 CATTTTATGGACAGGAAAACAGG - Intronic
1104021734 12:124996635-124996657 AATTTTAAATAAAGGAAAACTGG + Intronic
1104412531 12:128571248-128571270 CCTTTTCAGCAAATAAAAAAGGG - Intronic
1106297562 13:28430624-28430646 CCTTTTCAGCAATGGAAATAAGG + Intronic
1106572939 13:30945311-30945333 CATATAAACCCAAGGAAAAAGGG - Intronic
1106658599 13:31774723-31774745 AATTTTAAGCAAAGACTAAAAGG + Intronic
1106861740 13:33917084-33917106 CATTTTAAGCAAATGAAAACAGG - Intronic
1106973948 13:35183105-35183127 CATTTTTTGCAAATGAAAAAAGG - Intronic
1107311673 13:39085079-39085101 CATTTTAAGCAAAGTCAAAAAGG - Intergenic
1107372150 13:39764417-39764439 CATTTCAAGAAAAGAAAAAGAGG - Intronic
1107604361 13:42042990-42043012 CATTTGGAGCAAGGGGAAAAGGG + Intronic
1107607325 13:42072741-42072763 ATTTTTAAACAAAAGAAAAAGGG + Intronic
1107682147 13:42863246-42863268 CAATGTAAGCAAAGGAGACAGGG + Intergenic
1107734965 13:43389569-43389591 CATTTTTAAAAAAGGAAATAAGG - Intronic
1107870364 13:44740962-44740984 CATTTAAAGAAAAGGAAGAAAGG - Intergenic
1107993531 13:45839186-45839208 CTTTTTATACAAAGCAAAAACGG - Intronic
1108108040 13:47034712-47034734 TATTTTAAGGAAAGGCAACATGG + Intergenic
1108435206 13:50395784-50395806 CATTTTAGACATAGAAAAAAAGG - Intronic
1108562728 13:51662264-51662286 CATTTAAAAAACAGGAAAAAAGG - Intronic
1109363112 13:61322559-61322581 CATTATAAACAGAGTAAAAAGGG + Intergenic
1109540611 13:63774424-63774446 TGTTTTAAGCAAAAGAGAAACGG + Intergenic
1109568693 13:64156409-64156431 CATAATAAGGAAAGGAAAAGTGG + Intergenic
1109723828 13:66313826-66313848 GATTTTAAGCATTGGATAAATGG + Intronic
1109741286 13:66559298-66559320 CTTTGTAAGCATAGGAAAGAAGG - Intronic
1109954981 13:69553790-69553812 TATTCTAAGAAAAAGAAAAATGG - Intergenic
1110096544 13:71530500-71530522 TCTTTTTAGAAAAGGAAAAAGGG + Intronic
1110715945 13:78704339-78704361 CATTCTCAGCAAAGTAACAAAGG + Intergenic
1111012780 13:82332891-82332913 CATTTAAAGCAAATGAAAGAAGG - Intergenic
1111042326 13:82765623-82765645 CATTTTAAAAAAAAGAAAATTGG + Intergenic
1111367319 13:87266455-87266477 CATTTGAAAGAAAGTAAAAAAGG - Intergenic
1111649562 13:91072328-91072350 CATTTAAAGCAAATAGAAAATGG - Intergenic
1111655823 13:91151326-91151348 AATTTTAAACAATGGAAAACTGG + Intergenic
1111696007 13:91625099-91625121 CTGTTGAAGCAAAGAAAAAAGGG + Intronic
1112296280 13:98189966-98189988 CATTTCTAGTAAAGGAAACACGG - Intronic
1112629208 13:101141834-101141856 CACTATAAGCAAAAGAAAAAGGG + Intronic
1112736023 13:102419438-102419460 CATTTTCAGACAAGGAAAACTGG - Intergenic
1112813054 13:103241656-103241678 CATTTTAAGGAAACAAAAAATGG - Intergenic
1113326460 13:109286680-109286702 CATTTTAAAACAATGAAAAAAGG + Intergenic
1114177581 14:20336834-20336856 AAATTTAAAAAAAGGAAAAAAGG + Intergenic
1114257750 14:21017492-21017514 CACCGTAAGCAAGGGAAAAAGGG - Exonic
1115133501 14:30081672-30081694 GATTTTTAGCAAAGGTACAAAGG - Intronic
1115138596 14:30141842-30141864 AAATTTAAGGAAAAGAAAAATGG + Intronic
1115406240 14:33020499-33020521 CATTTTAAGCACTCGATAAATGG + Intronic
1115452482 14:33564235-33564257 CATGGTAACCAAAGCAAAAAGGG + Intronic
1115520956 14:34232670-34232692 CATTTCAAAAAAAAGAAAAAGGG - Intronic
1116014407 14:39389006-39389028 CATTTTCAGGAAAAGAAACATGG + Intergenic
1116261780 14:42637935-42637957 AAATTTAAGCTAAGGAAACATGG - Intergenic
1116381130 14:44269137-44269159 CATTTTGTGCAAAATAAAAATGG - Intergenic
1116860753 14:49993827-49993849 CATTTTAAGTAGAGGTAAACTGG + Intronic
1117139371 14:52771955-52771977 CATTTTGGACAAAGGAAAAAAGG - Exonic
1117399148 14:55342541-55342563 CTTTTTTAAAAAAGGAAAAAAGG - Intronic
1117645504 14:57847528-57847550 CATTATAAACAAAGGTAAAATGG + Intronic
1117734743 14:58757122-58757144 CATTATAAGCAAAATAAAATTGG - Intergenic
1117787026 14:59296800-59296822 CCTTTTAAGCAATGGCAAAAGGG - Intronic
1117890008 14:60410309-60410331 CTTCATAAGCAAAGGAGAAATGG - Intronic
1118562621 14:67102758-67102780 CATGCTAAGCCAAGGAAGAAAGG - Intronic
1119370289 14:74134637-74134659 AATTCTAAGAAAAGGAAAATGGG - Intronic
1119680924 14:76591657-76591679 TATTTTAAAGAAAGGATAAAGGG + Intergenic
1119878804 14:78083157-78083179 CATGTTCAGCAAAGGAGACAGGG - Intergenic
1119931496 14:78551808-78551830 CACTTGAAGAAAAGTAAAAAGGG - Intronic
1119983429 14:79108288-79108310 CATTCTAAGCAAAAGAGAATTGG - Intronic
1120025244 14:79576447-79576469 GTTTCTAAGCAAAAGAAAAAAGG + Intronic
1120623840 14:86799721-86799743 TATTATAAGCAATAGAAAAATGG + Intergenic
1121064929 14:90953837-90953859 CATCTTAAACAAAAGAAAACAGG - Intronic
1121771358 14:96544934-96544956 CATTTTAACCAAAGACCAAATGG + Intronic
1122098777 14:99390831-99390853 CAGTTGCAGCAAAGGAAACAGGG + Intergenic
1122728978 14:103780930-103780952 CCTTTTAGGCAAAGGTAAAGGGG + Intronic
1123153157 14:106201892-106201914 CAAGATAAACAAAGGAAAAAAGG - Intergenic
1123436772 15:20260347-20260369 CATTGAAAGCAAAGGAAAGGGGG - Intergenic
1123678989 15:22743294-22743316 CATTTTAAACCAAGTTAAAATGG - Intergenic
1124032987 15:26028179-26028201 CAAATTCTGCAAAGGAAAAATGG + Intergenic
1124331198 15:28817585-28817607 CATTTTAAACCAAGTTAAAATGG - Intergenic
1124444784 15:29721034-29721056 CCTTTTAAGCAAGGGGAAGAGGG + Intronic
1124882220 15:33653050-33653072 CATTGTATGCAGAGAAAAAAAGG + Intronic
1125040956 15:35186820-35186842 CATTTCCACCAAAGGAAAAGGGG - Intergenic
1125249262 15:37680856-37680878 TACTTTAAGCAGAGCAAAAATGG + Intergenic
1125428559 15:39574061-39574083 CCTCTTAAAAAAAGGAAAAAGGG + Intergenic
1126102055 15:45124445-45124467 TATTTTAAGTAAATAAAAAATGG + Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1126394113 15:48194212-48194234 CATTTTTAACAAAAAAAAAATGG - Intronic
1126424474 15:48512086-48512108 CATTTTAAGCAGAAAAAAACTGG - Intronic
1126514682 15:49521338-49521360 CCTTTGAAACAAAGGAAACATGG + Intronic
1126957382 15:53948770-53948792 CCTTTCAAGCAGAGGAAAAGGGG + Intergenic
1127020445 15:54740993-54741015 CATTCTAAGCAAAAATAAAAAGG + Intergenic
1127268403 15:57379467-57379489 CAAATTAAACAAAGAAAAAAAGG - Intronic
1127349635 15:58137522-58137544 CATTCTAATCAAACGAGAAAGGG - Intronic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1127799993 15:62469885-62469907 CATTTTGAGCTCAGGAAAGATGG - Intronic
1128210383 15:65895794-65895816 CTTTTTATGCATAGGAAAAAAGG + Exonic
1128298931 15:66551501-66551523 CATTCTAAGCAAATGAGTAAAGG + Intronic
1128351284 15:66891648-66891670 AGGTTTAAGCAAAGGGAAAAGGG - Intergenic
1128493976 15:68180433-68180455 CAATTAAGGGAAAGGAAAAAAGG - Intronic
1128752495 15:70159355-70159377 CATTGGAACCACAGGAAAAATGG - Intergenic
1128880745 15:71240340-71240362 CATTTTTAATGAAGGAAAAATGG - Intronic
1129485556 15:75867883-75867905 CAATTTAGGGAAATGAAAAAAGG + Intronic
1129703072 15:77779053-77779075 CATTCAAAGCAGAGGAAACAGGG - Intronic
1130119336 15:81033737-81033759 CCTTGCTAGCAAAGGAAAAATGG - Intronic
1130228436 15:82077987-82078009 CATTTTAAACAAAACAAAGAGGG + Intergenic
1130719632 15:86373822-86373844 CATTTTAAGTAAAATATAAATGG - Intronic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1130837592 15:87666025-87666047 AGGTTTAAGCAAAGTAAAAAGGG + Intergenic
1131093889 15:89644036-89644058 AATATTCAGCAAAGAAAAAAGGG + Intronic
1131604279 15:93884487-93884509 CCTGTTTAGCAAAGGCAAAAAGG - Intergenic
1131975217 15:97938143-97938165 CAATTTAAGAAAAAAAAAAAAGG - Intergenic
1132388851 15:101423640-101423662 CATTCGAAGCAGAGAAAAAAGGG + Intronic
1133076504 16:3284523-3284545 CATTTTACGAATAGGAAAACAGG - Intronic
1133397703 16:5461555-5461577 CATTTTCAGCTGAGGAAAAAGGG + Intergenic
1133614827 16:7466425-7466447 CATTTTAAGGATAAGAAAAGAGG + Intronic
1134166784 16:11936633-11936655 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134525851 16:14942823-14942845 CAACTTACCCAAAGGAAAAAAGG - Intronic
1134546555 16:15113538-15113560 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134547040 16:15118021-15118043 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134581267 16:15372810-15372832 CAACTTACCCAAAGGAAAAAAGG + Intronic
1134713432 16:16341317-16341339 CAACTTACGCAAAGGATAAAAGG - Intergenic
1134721302 16:16384675-16384697 CAACTTACGCAAAGGATAAAAGG - Intronic
1134946124 16:18327209-18327231 CAACTTACGCAAAGGATAAAAGG + Intronic
1134953387 16:18367353-18367375 CAACTTACGCAAAGGATAAAAGG + Intergenic
1135312175 16:21414050-21414072 CAACTTACCCAAAGGAAAAAAGG + Intronic
1135348139 16:21706659-21706681 GATTTTAAGCAAATTGAAAAGGG - Intronic
1135365123 16:21846506-21846528 CAACTTACCCAAAGGAAAAAAGG + Intronic
1135446716 16:22524833-22524855 CAACTTACCCAAAGGAAAAAAGG - Intronic
1135563633 16:23495200-23495222 AATTTTAAGAAAAAGGAAAAGGG - Intronic
1135692758 16:24556612-24556634 CATTTAAAGCAAATTTAAAATGG + Intronic
1135752834 16:25070611-25070633 CATTTAAAGAAAAGAAAAACAGG - Intergenic
1135781518 16:25306407-25306429 ATTTTTAAAGAAAGGAAAAAAGG - Intergenic
1136098960 16:27979263-27979285 CATTTTTAAAAAAGAAAAAAAGG + Intronic
1136151346 16:28351970-28351992 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136167578 16:28465811-28465833 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136195398 16:28649204-28649226 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136211736 16:28763320-28763342 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136256457 16:29043271-29043293 CAACTTACCCAAAGGAAAAAAGG - Intronic
1136308878 16:29393041-29393063 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136322295 16:29494572-29494594 CAACTTACCCAAAGGAAAAAAGG + Intronic
1136436974 16:30234544-30234566 CAACTTACCCAAAGGAAAAAAGG + Intronic
1137415963 16:48279739-48279761 TATTTTAAGCAAGGGTAAAAGGG - Intronic
1137988973 16:53132372-53132394 GATTTTAAGAACTGGAAAAAAGG - Intronic
1138010868 16:53378666-53378688 CCTTTTTAGAAAAGGGAAAATGG + Intergenic
1139938417 16:70587648-70587670 CATTTTAAGCTTAGGAAAGTAGG - Intronic
1140017414 16:71200942-71200964 CAGTTTGATCAAAGGAAACAGGG - Intronic
1140325550 16:73998334-73998356 GATTTGAAGTAAATGAAAAAAGG - Intergenic
1140366148 16:74382585-74382607 CAACTTACCCAAAGGAAAAAAGG - Intronic
1140966919 16:79975891-79975913 TCTTTTAAGCAAAAGGAAAAAGG + Intergenic
1141364695 16:83431944-83431966 GATTTTGAGCAGAGGAAAGAGGG + Intronic
1141469016 16:84225966-84225988 CATTCGAAGAAAAGAAAAAAAGG + Intronic
1141487796 16:84352460-84352482 TCTATTAAGCAAAGCAAAAAAGG - Intergenic
1141529254 16:84634842-84634864 CATTTTAAGAAAAAAAAAAGAGG - Intergenic
1143439220 17:6955380-6955402 AATTTTAAGAGAAGAAAAAAGGG - Intronic
1144562849 17:16336019-16336041 CATTTTAAATAAATGAAGAATGG + Intronic
1145721478 17:27077197-27077219 CATTGGAACCAAAGAAAAAAGGG + Intergenic
1146754132 17:35411415-35411437 GATTTTCTGCAAAGGAAAACTGG + Exonic
1147615163 17:41823177-41823199 TATTTGGAACAAAGGAAAAAAGG - Exonic
1148326252 17:46785079-46785101 CATCATAAGAAAAGCAAAAAGGG - Intronic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1149824228 17:59812480-59812502 CAATTTAAACGAAGGGAAAATGG + Intronic
1149824468 17:59815054-59815076 AATTTTAAGCTGAGGAAAAAGGG - Intronic
1150053083 17:61984444-61984466 CTGTTTAAAGAAAGGAAAAAAGG - Intronic
1151132358 17:71910410-71910432 CATTCTAAGCAAAAGAGACAAGG - Intergenic
1151147471 17:72054423-72054445 AATTATAAGCAAGAGAAAAAAGG + Intergenic
1151330500 17:73404038-73404060 TTTTTTAAATAAAGGAAAAAGGG + Intronic
1153176600 18:2381162-2381184 CACTTTATGCAAAAGAAATAAGG - Intergenic
1153835575 18:8961087-8961109 CATTTTAAGTAAAACAAACAGGG + Intergenic
1154118055 18:11628737-11628759 CAACTTACCCAAAGGAAAAAAGG + Intergenic
1154444511 18:14423980-14424002 CATTTTAAACAACAGAAAACAGG + Intergenic
1154928600 18:20967268-20967290 CTTTTTAAGGCAAGGAGAAAAGG - Intronic
1154966705 18:21365261-21365283 CTTTTTAAACAAAGTAACAAAGG + Intronic
1155002420 18:21699991-21700013 CTTTATAAGCAATGGACAAAAGG + Intronic
1155101495 18:22614709-22614731 GATTTTCAGAAAAAGAAAAAGGG + Intergenic
1155187745 18:23402199-23402221 CATTTGAATCACTGGAAAAATGG + Intronic
1155605755 18:27604006-27604028 CATTTTAAGAAATGGAACTAGGG + Intergenic
1155720204 18:29001921-29001943 TTTTTTAAGCCAAGAAAAAAAGG + Intergenic
1156282685 18:35656546-35656568 CCTTCCAAGCAAAGGAAAGAAGG + Intronic
1156329765 18:36109162-36109184 GAATTTAAGCAAAGAAATAAAGG - Exonic
1156603153 18:38634446-38634468 CTTTTGAATCAAAGCAAAAATGG + Intergenic
1156651302 18:39229421-39229443 CATTTAAAGAGAAGGAAACAAGG - Intergenic
1156732912 18:40216786-40216808 CATTTTAAACAAAGAAAAGTTGG - Intergenic
1156805940 18:41181733-41181755 TATTTTAAGAAAAGGCAACATGG - Intergenic
1157074596 18:44451320-44451342 CATTGTATGTAAAGTAAAAAAGG + Intergenic
1157542830 18:48524348-48524370 CATTTTAGCCAAAGGAAACTAGG + Intergenic
1157686506 18:49646746-49646768 TATTTTAAGGAAAGGCAACATGG - Intergenic
1157929033 18:51800147-51800169 CCTTTTTAGCAAAGAAAGAATGG - Intergenic
1157947257 18:51994262-51994284 AAATTTAATAAAAGGAAAAATGG - Intergenic
1158187942 18:54792479-54792501 CAGTTTATGCAAATGAATAAAGG - Intronic
1158365607 18:56731309-56731331 TAGTTTAAGTAAAGAAAAAATGG - Intronic
1158459904 18:57637203-57637225 CGTTTTAAGGGAAGGAATAAAGG - Intergenic
1158752204 18:60275026-60275048 CATTCAAATCAAAGCAAAAATGG + Intergenic
1158828927 18:61256823-61256845 GGTTTTAAGCAAGAGAAAAATGG + Intergenic
1158862861 18:61610014-61610036 TAGGTTAAGCAAAGGAAAAGGGG - Intergenic
1159347734 18:67228391-67228413 CATTTTAAACAACAGAAAACAGG - Intergenic
1159578706 18:70210397-70210419 CATTTCCAGCAACAGAAAAAGGG + Intergenic
1159620167 18:70628181-70628203 CATATTCAGAAAAGGATAAATGG - Intergenic
1159750656 18:72297264-72297286 AATATTAAGAGAAGGAAAAATGG - Intergenic
1159966637 18:74601455-74601477 CATTTTAGGCAATGCAAGAATGG - Intronic
1160062769 18:75548010-75548032 CATTCTCAGCAAACTAAAAAAGG + Intergenic
1160335830 18:78038405-78038427 AATTTTCAGCAAGGGAATAATGG + Intergenic
1160462126 18:79047364-79047386 CATTTTCAGCAAGATAAAAATGG + Intergenic
1162155132 19:8672899-8672921 GCTTTTAAGCAAAGGATAAATGG + Intergenic
1162991642 19:14306706-14306728 CATTGTAAGTCAAGGAAAATCGG + Intergenic
1163503964 19:17693352-17693374 AATTTTAAGAAATGGACAAAAGG - Intergenic
1163573740 19:18098639-18098661 CATTATAAGAAAAGAAAAACAGG + Intronic
1163626451 19:18392678-18392700 CATTTTTAAGGAAGGAAAAAGGG - Intronic
1163739945 19:19005286-19005308 CACTTGGACCAAAGGAAAAATGG + Intronic
1164296859 19:23918229-23918251 CCTTGAAAGCAAGGGAAAAAAGG + Intronic
1164894262 19:31856891-31856913 GATTTTTAGCAAAGGAAAAAAGG + Intergenic
1165537967 19:36465977-36465999 CAGTTTAATAGAAGGAAAAAAGG + Intronic
1165681575 19:37780834-37780856 CTTTTTAAGAAGAGGAAAATCGG - Intronic
1166298241 19:41899447-41899469 CACAATTAGCAAAGGAAAAAAGG - Intronic
1167205184 19:48096727-48096749 CATTTTATGCTTAGGAAATAGGG + Intronic
1167799883 19:51733415-51733437 CATTTTCAGCAAAGTAACACAGG + Intergenic
1167912806 19:52717814-52717836 CATGTTAGGGTAAGGAAAAAAGG + Intronic
1202666693 1_KI270708v1_random:127407-127429 CATTTTTAGGCAAGAAAAAAGGG - Intergenic
925213376 2:2070747-2070769 CATTTTAAGAAAAAGACAAAGGG + Intronic
925305270 2:2843960-2843982 CATTTTAAGCAAAGACTAAGGGG - Intergenic
925315084 2:2916020-2916042 CAATTTTAACAAATGAAAAAAGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925687003 2:6482911-6482933 CATGTCAAGCAGAGGAAAGAGGG + Intergenic
925697533 2:6596652-6596674 GCTCTTAAGAAAAGGAAAAAGGG - Intergenic
925811914 2:7709477-7709499 CATTTTAGGCCAAGGCAAACTGG + Intergenic
926122045 2:10246799-10246821 GATTGTAAGCAAATGAGAAATGG + Intergenic
926215032 2:10901014-10901036 CAATTAAAGTAAAGGAAAATGGG + Intergenic
926236806 2:11051794-11051816 CATTTAGAGCCAAGGAAGAAAGG + Intergenic
927086672 2:19679230-19679252 CATTTTCAGAGAAAGAAAAAGGG - Intergenic
927274705 2:21252890-21252912 CATTTTAAGCAATGGCGGAATGG - Intergenic
928441939 2:31299561-31299583 TATTTAATGCAAAGGAAAAGTGG - Intergenic
928523965 2:32120710-32120732 CATAATAAAGAAAGGAAAAAAGG - Intronic
928825958 2:35421245-35421267 CTTTATAAGCAGAGGAAATATGG - Intergenic
928986763 2:37189765-37189787 CAACTTACCCAAAGGAAAAAGGG - Intronic
929322472 2:40561275-40561297 CATTTGAAGTAAGGGAAAATAGG + Intronic
929445940 2:42001476-42001498 CATTTTAAAAAAAGCAAAAATGG - Intergenic
929619940 2:43344302-43344324 CATTTTAAGGAAACTTAAAAGGG - Intronic
929636602 2:43528771-43528793 AATTTTAAAAGAAGGAAAAAAGG - Intronic
930849610 2:55944947-55944969 CATTTTCAGACAAGCAAAAATGG - Intergenic
931324372 2:61203031-61203053 CACTTTAAAAAAAGAAAAAAAGG + Intronic
931793555 2:65688098-65688120 TGTATTAAGCATAGGAAAAAAGG - Intergenic
931829117 2:66032310-66032332 CAAGTCAAGCAAAGGAGAAATGG - Intergenic
932071935 2:68629220-68629242 CATCTTAAACAACGGAAAACAGG + Intronic
932222917 2:70014204-70014226 CACTTTCAGCAGAGTAAAAAAGG + Intergenic
933147116 2:78867649-78867671 CATTTTAGGCAGATGAATAAGGG + Intergenic
933218567 2:79660820-79660842 CCTTTTAAAATAAGGAAAAAAGG + Intronic
933417604 2:82006158-82006180 CATTTTTAGCAAATGGGAAAGGG + Intergenic
933553748 2:83807269-83807291 AATTTTAAAAAAAGGAAAGAAGG + Intergenic
933635315 2:84702407-84702429 CATTTTAAACACACTAAAAATGG + Intronic
933765166 2:85702983-85703005 CATTTTAAGACAATGGAAAAAGG - Intergenic
935547046 2:104411358-104411380 CTTTTAAAGAAAAAGAAAAATGG + Intergenic
936401760 2:112169937-112169959 TGTTTTAAGAAAAGGAAGAAGGG + Intronic
936616539 2:114053648-114053670 GATTTTAAGCCAATGAAGAAGGG + Intergenic
936801598 2:116274717-116274739 AATTTTTAGCAAAGGTCAAAAGG + Intergenic
937109557 2:119353520-119353542 CATTATAATAAAAAGAAAAAAGG + Intronic
937730856 2:125227062-125227084 CATTTTAAACAAAGACAAACAGG + Intergenic
937842933 2:126543902-126543924 CAATCTAAACAAAGGCAAAAAGG + Intergenic
937845896 2:126578616-126578638 AATCTGAAGCAAAAGAAAAAAGG + Intergenic
939746231 2:145972403-145972425 CATTTTGAGCAAAAAAGAAAAGG + Intergenic
939765005 2:146237319-146237341 CAGTTTAAGAAGTGGAAAAAAGG - Intergenic
940093026 2:149943346-149943368 TAATTTCAGCAAAGGAAAAGAGG - Intergenic
940151241 2:150603665-150603687 GATTTTAAAAAAAGGAGAAAAGG + Intergenic
940255102 2:151719922-151719944 CATTTTAGGCATAGGACAACAGG + Intronic
940377659 2:152973891-152973913 CAATGTCAACAAAGGAAAAAGGG - Intergenic
940387819 2:153094198-153094220 CATCTTAAGGAATGAAAAAAGGG - Intergenic
940510842 2:154612698-154612720 GATTTTAATCATAGGAAATAAGG + Intergenic
941107778 2:161379106-161379128 CATATAAAGCAAAGCAATAAAGG - Intronic
941356609 2:164500915-164500937 CCTCTTAATCATAGGAAAAATGG - Intronic
941429461 2:165395116-165395138 CATTTTCAGAAAAAGAAAAACGG - Intergenic
941718429 2:168787711-168787733 CAGTTTTTGGAAAGGAAAAATGG + Intronic
942099408 2:172564384-172564406 CAATTTAATAAAAGGAAAATCGG - Intronic
942315820 2:174695711-174695733 CATTTTTAGTAAAGGAAAAATGG + Intergenic
942416716 2:175767212-175767234 CAGTTTAAGACAAGAAAAAAGGG - Intergenic
942827007 2:180190671-180190693 CATTTTAAGAAAGGGAAAGGAGG + Intergenic
943230348 2:185242858-185242880 GAATTTAAGCAATGCAAAAATGG + Intergenic
943358484 2:186889553-186889575 CATATTCAGAAAATGAAAAAAGG + Intergenic
943376517 2:187084300-187084322 CAGCTTAAGCAAAGGCAAAGAGG + Intergenic
943394570 2:187317578-187317600 CATGTTAAGCAAAGGACATTTGG - Intergenic
943693952 2:190903035-190903057 AATTTTCATAAAAGGAAAAAAGG - Intronic
943830081 2:192449718-192449740 CCTTTTTAACAAAGGAACAAAGG + Intergenic
943868879 2:192966223-192966245 CAGTTTCAGCAAAGGAGAAAAGG + Intergenic
943925033 2:193765708-193765730 CACTTTAAAAAAAGTAAAAATGG - Intergenic
943936731 2:193928054-193928076 CATATCAAGCAAGGGAGAAAAGG + Intergenic
944396757 2:199276749-199276771 CATTTTGAAAAAAGGGAAAAAGG - Intronic
945413379 2:209540250-209540272 CATTTTAAGAAAAGTAAAAAAGG + Intronic
945432250 2:209777801-209777823 CATATTAAGCATAGAATAAAAGG + Intronic
945443097 2:209904064-209904086 TATTTTAAGATAAGGAATAAAGG - Intronic
945490348 2:210447250-210447272 CTTCATAAGCAAAGGAGAAATGG + Intronic
945566258 2:211403906-211403928 CATGTTAGGCAAAGGAAACTGGG - Intronic
945897332 2:215498396-215498418 TTTTTTAACCAAAGGTAAAAAGG - Intergenic
946617535 2:221526127-221526149 CATTTTAAGCTAAGGAAACTGGG + Intronic
946617548 2:221526298-221526320 CATTTTAAGCTACGGAAACTGGG + Intronic
946637927 2:221750940-221750962 CATTTTAATCAGAAGAACAATGG + Intergenic
946760082 2:222984869-222984891 CATTTTAGCCAAATGAAATATGG - Intergenic
947542643 2:230989622-230989644 CATTTTAAGAAAAATAACAAAGG + Intergenic
947574588 2:231262622-231262644 GAATTTGAGAAAAGGAAAAACGG - Intronic
948404989 2:237710781-237710803 CCTTTCAATCAAAGGAATAAAGG - Intronic
948426557 2:237890970-237890992 AATTTTAAGAAAGGGAAAAGGGG - Intronic
948504584 2:238419865-238419887 CATTTAAAACACAGGCAAAATGG - Intergenic
1169298693 20:4423155-4423177 CACTAAAAGCAAAGGAACAAAGG + Intergenic
1169780888 20:9309076-9309098 CATTTTAAACACAGGAGAAATGG - Intronic
1170009980 20:11712288-11712310 CATTTTAAAAATATGAAAAAAGG + Intergenic
1170151977 20:13235926-13235948 CATTTCAAAAAAAAGAAAAAAGG - Intronic
1170732902 20:18989581-18989603 CATTTTTAGCAAAAGAGAAAAGG + Intergenic
1171002853 20:21432235-21432257 GATTTTCAGCAAAGACAAAAAGG - Intergenic
1171964132 20:31516593-31516615 CATTCTAAGCAAAAGAAACCAGG + Intronic
1172490712 20:35335126-35335148 CATTATAAACAAATGAACAATGG + Intronic
1172743786 20:37190832-37190854 CATTATAAGTAATGGAAGAAAGG + Intronic
1173269133 20:41515910-41515932 CTTTTTAAGCAATGGATAGATGG + Intronic
1173951030 20:46993371-46993393 CAGTTAAAGCAAAGGAAAAGGGG - Intronic
1173975234 20:47182016-47182038 CATCTTAAAAAAAAGAAAAAAGG - Intronic
1174126405 20:48310129-48310151 CATTTTCTCCAAAGGGAAAATGG - Intergenic
1174312385 20:49667855-49667877 CATTTTAAGCAGATTTAAAATGG - Intronic
1174818974 20:53711183-53711205 CATTTTAGGTAAGGGAAACAGGG - Intergenic
1174865452 20:54131239-54131261 CATTCTCAGCAAATGAAAACAGG - Intergenic
1174876854 20:54235920-54235942 CATTTGAAACAAGTGAAAAACGG + Intergenic
1174894563 20:54435023-54435045 GATTTTAAAGAAAGGAGAAAAGG + Intergenic
1175019745 20:55832477-55832499 CATAATAACCTAAGGAAAAATGG - Intergenic
1175073556 20:56355092-56355114 CATCTTAAGAAAAAAAAAAAAGG - Intergenic
1175346632 20:58283443-58283465 AATTTTTATCATAGGAAAAATGG - Intergenic
1175595761 20:60231443-60231465 TCATGTAAGCAAAGGAAAAAAGG - Intergenic
1175654979 20:60762137-60762159 CATTTTTTGCAAAGCAAAAATGG + Intergenic
1177309692 21:19374181-19374203 CATTTTTACCAAAGGAAAACAGG - Intergenic
1177407559 21:20690241-20690263 CATTTTGAGCAAAGCAAACAGGG + Intergenic
1177417563 21:20814055-20814077 CATTTTAATCAACAGAAAATTGG - Intergenic
1177576308 21:22960779-22960801 CATTTGAAGCAAATAATAAAAGG - Intergenic
1177818723 21:26007194-26007216 AATTTTAAGTAGAGTAAAAAGGG + Intronic
1178058702 21:28828324-28828346 GATTTCAAGCTAAGGAAAGAGGG + Intergenic
1178060583 21:28849661-28849683 CATTTTAAGAAAAAAAGAAACGG + Intergenic
1178159251 21:29892754-29892776 CATTTCAAGCAAAAAGAAAAAGG - Intronic
1178202938 21:30428579-30428601 CATTTGAAACAAAAGAAAATGGG + Intergenic
1178249878 21:30992336-30992358 CATTTAAAGGAAAGGAAAAACGG + Intergenic
1178766355 21:35455201-35455223 CAATTTAAGGAAAACAAAAAGGG + Intronic
1179341507 21:40514509-40514531 CATTTTATGCAATGTCAAAAAGG - Intronic
1180736762 22:18023423-18023445 CATTGTAAAGAAATGAAAAAAGG - Intronic
1181146637 22:20853152-20853174 CATTTTAGGACATGGAAAAAGGG + Intronic
1181989535 22:26826897-26826919 GATTTTTATCTAAGGAAAAATGG + Intergenic
1183647241 22:39133864-39133886 CAGTTTAAGAAGAGTAAAAACGG + Exonic
1184051258 22:42006571-42006593 CATTTTTAACAGAAGAAAAATGG - Intronic
1184184388 22:42855104-42855126 CATTTTCAGAGGAGGAAAAAAGG + Intronic
1185002585 22:48255037-48255059 TATTCTAACCAAAGGGAAAATGG - Intergenic
949672478 3:6415624-6415646 CATTTTAAACATGGGAAAACTGG + Intergenic
950037223 3:9895330-9895352 ATTTTTAAGCAAAGGAAACTGGG - Intergenic
950323852 3:12085695-12085717 TATTTTAAGACAAGCAAAAATGG + Intronic
951305606 3:21057194-21057216 CATTTTAAGGAAGAAAAAAATGG + Intergenic
951945901 3:28135592-28135614 CACTTTAAGGAATGAAAAAATGG - Intergenic
952944661 3:38470487-38470509 CATTTTGAGAAAAGCAACAAAGG + Intronic
953774592 3:45804428-45804450 CATTATAACAGAAGGAAAAAAGG - Intergenic
953894173 3:46782343-46782365 GATTTTTAACAAAGGAACAAAGG + Intronic
954981293 3:54747848-54747870 CATTTTTAGAAAAGGAAGATGGG - Intronic
955714900 3:61819059-61819081 CACTATAAGGAAAGGAAAATTGG + Intronic
956199075 3:66687385-66687407 CATTTGAAACAAATGAAAAAAGG + Intergenic
956450853 3:69373208-69373230 CATTTAAACTAAAGTAAAAAGGG - Intronic
957003638 3:74917118-74917140 AAATTTAAGCAGAAGAAAAATGG + Intergenic
957156876 3:76555174-76555196 AATTTTAAGGAGAGGAAAATAGG + Intronic
957288127 3:78243212-78243234 CAACTGAAACAAAGGAAAAAGGG - Intergenic
957398696 3:79680005-79680027 CATTTTAAGCAATGGAAATTTGG - Intronic
957449141 3:80353903-80353925 CATGTTAAGGAAAAGAAAATTGG - Intergenic
957826075 3:85446531-85446553 CATTTGAAGATAAGGATAAAAGG + Intronic
958086196 3:88810815-88810837 CAATTTAAGCAAAAGAAAGTTGG + Intergenic
958097902 3:88971393-88971415 TATATTAAATAAAGGAAAAATGG + Intergenic
958259649 3:91365738-91365760 CATTTAAAGCAAAAGAAGGAAGG + Intergenic
958712301 3:97732096-97732118 GATTTTATGCAAAGGGGAAAAGG - Intronic
958787138 3:98610314-98610336 CATTTTCATCAAAAGAAGAAAGG + Intergenic
959220665 3:103514652-103514674 CATTTTAAGGGATGGACAAAGGG - Intergenic
959374829 3:105576205-105576227 CATTTAAACCAAAGTAAAAGGGG + Exonic
959492166 3:107003187-107003209 CATTTTAACCAGAAGCAAAAAGG - Intergenic
960240324 3:115333327-115333349 CATGGAAAGGAAAGGAAAAAGGG - Intergenic
960703922 3:120463905-120463927 CATTTAAAACCAAAGAAAAATGG - Intergenic
961061033 3:123829093-123829115 AAATTTATCCAAAGGAAAAAAGG + Intronic
961192962 3:124977712-124977734 CATTTTTAAAAAAGGAGAAAGGG - Intronic
961218346 3:125179463-125179485 CATTTTGTGTAAAGGCAAAAGGG + Intronic
961905460 3:130258451-130258473 TTTTTTAAGCACAGGAAACATGG - Intergenic
961923260 3:130449736-130449758 CGTTTTAAACAAAGGAGATAAGG - Intronic
962129014 3:132652560-132652582 CAGTGTAAGCAAAAAAAAAATGG - Intronic
962134361 3:132718678-132718700 CATTTTAGCCAAGGGAAAGAAGG - Intronic
962434683 3:135355541-135355563 CATAGTAAGCAACCGAAAAATGG - Intergenic
962449646 3:135502266-135502288 CATTCTAGGCATGGGAAAAATGG - Intergenic
962560551 3:136602078-136602100 CATTTAAAGAAAAGGAAGTAAGG + Intronic
962818527 3:139023691-139023713 TAATTTAAAAAAAGGAAAAATGG - Intronic
963279146 3:143364743-143364765 CATTTTAAACAAAGGATAAATGG - Intronic
963649842 3:147965018-147965040 CATTTTAATAAATGTAAAAAAGG + Intergenic
964083295 3:152786168-152786190 TTATTTAAACAAAGGAAAAACGG - Intergenic
964137082 3:153356135-153356157 CATTTTAAAGAAAGAAAAAAAGG + Intergenic
964180233 3:153874671-153874693 CATTTTAAACAACAGAAAACAGG + Intergenic
964238932 3:154568756-154568778 TATTTTAGGCACAGGAAATATGG - Intergenic
964407564 3:156365231-156365253 CATTTTAAAAATGGGAAAAATGG + Intronic
964522137 3:157581162-157581184 CACTTTCAGAAAGGGAAAAATGG - Intronic
964665486 3:159167313-159167335 CATTTTCTGAAAAGGAAAATTGG + Intronic
964865256 3:161252287-161252309 CATTTCAAACACACGAAAAAGGG - Intronic
965196890 3:165610078-165610100 AATATAAAACAAAGGAAAAATGG + Intergenic
965198227 3:165625681-165625703 TATTTTACTCAAAGGAAAGAGGG + Intergenic
965332178 3:167389243-167389265 CATTTTCAGCAAAGTAACATAGG - Intergenic
965459933 3:168949915-168949937 CACTTTCAGAAAAGTAAAAAAGG + Intergenic
965648809 3:170911868-170911890 CACTTTAGGCAAAGGAAATGGGG + Intergenic
965867526 3:173223318-173223340 CAATTTTAGGAAGGGAAAAAAGG + Intergenic
966524209 3:180903466-180903488 CATCTCAAAAAAAGGAAAAAGGG + Intronic
966811672 3:183851857-183851879 CATTTAAAAAAAAGGAAAATAGG + Intronic
967043132 3:185712234-185712256 CATTTCACACCAAGGAAAAAAGG - Intronic
967401711 3:189070074-189070096 CATTTCAAAAAAAGAAAAAAAGG + Intronic
967767931 3:193302510-193302532 TATTCTAAGTAAAGGATAAATGG + Intronic
967778843 3:193413767-193413789 CATCTTAAGCAACAGAAAACAGG - Intronic
968254920 3:197260957-197260979 CTTTTTTAGCAAAGAAAAAAAGG - Intronic
968633698 4:1666697-1666719 CATTTAATCAAAAGGAAAAATGG + Intronic
969913521 4:10466787-10466809 CAAAGAAAGCAAAGGAAAAAAGG - Intergenic
970261630 4:14230916-14230938 CATTTTAAGGAAAAGAAATTAGG + Intergenic
970775226 4:19666772-19666794 CATTTATACCAAAGGAAACAAGG - Intergenic
971074848 4:23135698-23135720 GACTTTAAACAAGGGAAAAATGG + Intergenic
971132696 4:23830732-23830754 GATTTTTAGCAAATGACAAATGG + Intronic
971893770 4:32562593-32562615 CATTTTAAGCAAAGGAAGTCAGG - Intergenic
971908371 4:32759591-32759613 TATTTTAAGCAAAGTAACACAGG + Intergenic
972040041 4:34582200-34582222 CATTTTAAGTACAAAAAAAATGG - Intergenic
972046826 4:34676282-34676304 AATATTAAGCAAAGAAAGAAGGG - Intergenic
972071615 4:35026349-35026371 ATTTTAAATCAAAGGAAAAAGGG - Intergenic
972122635 4:35724708-35724730 TATTTAAAACAAAGCAAAAATGG - Intergenic
972338544 4:38130216-38130238 AATGTTAAGTAAAGGAAAAGTGG + Intronic
973112905 4:46416998-46417020 CATTTTAGGGAGAGAAAAAAAGG + Intronic
973223304 4:47753364-47753386 CATCTTAAGCAACAGAAAACAGG + Intronic
973691290 4:53435688-53435710 ATTTTTAAGAAAAGAAAAAAGGG - Intronic
973752578 4:54037057-54037079 CATAGTAAGTAAAAGAAAAAGGG + Intronic
973854295 4:54995242-54995264 CTTTTTAAAGAAAGGAGAAAAGG - Intergenic
973863145 4:55085627-55085649 TATTTTATAGAAAGGAAAAAAGG + Intronic
973874107 4:55197997-55198019 TATTACAAGCTAAGGAAAAAAGG + Intergenic
973981740 4:56313770-56313792 CATATTAAGGAAAGGAATTAGGG + Intronic
973993310 4:56433531-56433553 CATTTAAAGGGAAGGAGAAAGGG + Intronic
974093203 4:57333997-57334019 CATCTTAAACAAAGTAAAAGAGG - Intergenic
974302398 4:60084915-60084937 TATTCCAAGCAAAAGAAAAAGGG + Intergenic
974385367 4:61197724-61197746 AATTTTTACCAAAGGGAAAAGGG - Intergenic
974401321 4:61411514-61411536 CATATTAGGCAAAGAAAAATTGG - Intronic
974605543 4:64145675-64145697 CCTTTTGAGCAGAGGAATAAGGG + Intergenic
974998357 4:69191917-69191939 CATTTTAAACAACAGAAAACAGG - Intronic
975113606 4:70653910-70653932 AATTTTCAGCAAAGATAAAAAGG + Intronic
975199457 4:71568844-71568866 CTTTTAAAGAAAGGGAAAAATGG - Exonic
975431718 4:74300016-74300038 CAGTTAGAGCAAAGGAAGAAAGG + Intronic
975554218 4:75644598-75644620 CAGCTTAAAGAAAGGAAAAAAGG + Exonic
975915210 4:79317139-79317161 GATTTTAAGAAAAGGACAAACGG - Exonic
976147466 4:82056050-82056072 CATTTTCAGCAACTGCAAAATGG + Intergenic
976209626 4:82654542-82654564 TTCTTTAAGCAAAGCAAAAAGGG + Intronic
976229760 4:82829619-82829641 AATTATAAGCAAAGTAAAAAAGG + Intronic
976430577 4:84959288-84959310 AATTTTAAGCAGAAAAAAAAAGG + Intronic
976476588 4:85490970-85490992 TATATTAAGCAAAGGCAAATAGG - Intronic
976505926 4:85847556-85847578 AATTTTCAGCAAAGGAGCAAAGG + Intronic
976631916 4:87247408-87247430 CATTTTCTGCAAAAAAAAAAAGG - Intergenic
976733921 4:88291618-88291640 GAATTACAGCAAAGGAAAAACGG + Intergenic
976968817 4:91079138-91079160 AAGTTGAAACAAAGGAAAAAAGG + Intronic
976971144 4:91104149-91104171 CATTTTAAACAACAGAAAACAGG - Intronic
977151979 4:93523848-93523870 CATGTTGCACAAAGGAAAAAAGG + Intronic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977299154 4:95248067-95248089 CATTTTAATTACAGGAAAAATGG - Intronic
977491263 4:97715285-97715307 CATTTTAATCACAGGTAATAAGG + Intronic
977530692 4:98197129-98197151 CAATTCAAGCAAAGGAACACAGG - Intergenic
977559808 4:98520754-98520776 TATTTTAAGAAATGGATAAAAGG - Intronic
977745602 4:100543046-100543068 CGCTTTAAGAAAAAGAAAAAAGG - Intronic
977972645 4:103229499-103229521 CACTTTCAGAAAAGGAAAAGTGG + Intergenic
978287037 4:107091714-107091736 TATTTTAAGCAAACTAATAAAGG + Intronic
978367725 4:107999931-107999953 TATCTTATGCTAAGGAAAAAGGG + Intronic
978877359 4:113657692-113657714 CATTTTAAACCAACTAAAAATGG - Intronic
979040396 4:115784203-115784225 CATTTTAAGAAAAATAAACAAGG - Intergenic
979333025 4:119438455-119438477 TAATTTATGAAAAGGAAAAAAGG + Intergenic
979425189 4:120555162-120555184 CATTTTAGCCAAAGGACAGAGGG - Intergenic
979452487 4:120888919-120888941 CAATTTAAAAAAAAGAAAAATGG - Intronic
979694113 4:123592268-123592290 CTTTTAAAGAGAAGGAAAAAGGG + Intergenic
979703289 4:123691440-123691462 AATATTAAGAAAAGCAAAAATGG + Intergenic
979793184 4:124812262-124812284 CATTTTAAACAACAGAAAACAGG + Intergenic
979833601 4:125332229-125332251 CATTTTAAGGAAAAGACACAAGG + Intronic
980175795 4:129342556-129342578 CATTGGAAGAAAAGGAAGAATGG + Intergenic
980180922 4:129399630-129399652 CATCTTAAACAAAAGAAAACAGG + Intergenic
980424034 4:132601984-132602006 TATTTTAAACTAAGTAAAAATGG - Intergenic
980547345 4:134284578-134284600 CTTTTTAAGCAACACAAAAATGG - Intergenic
980619473 4:135279949-135279971 CATCTTAAGGAATAGAAAAAGGG + Intergenic
981247908 4:142561995-142562017 GATCTTAATCAAAAGAAAAAAGG - Intronic
981472607 4:145153541-145153563 CATTTTTAATATAGGAAAAATGG - Intronic
981529431 4:145737353-145737375 CATATTATGCAAAGGCAAAATGG + Intronic
981657940 4:147133356-147133378 CATTTCAGGCAAAGCAGAAAGGG - Intergenic
981880373 4:149603838-149603860 AATATTAAGAAGAGGAAAAAGGG - Intergenic
982233777 4:153233156-153233178 CATTTAAAGTAGAGGAGAAATGG + Intronic
982588004 4:157267056-157267078 CAATTTAAAAAAAGAAAAAAAGG + Intronic
982604622 4:157498738-157498760 CTTTTTAAGCAATGTAAGAAGGG + Intergenic
983297882 4:165889802-165889824 TATTTTAAATAAAGAAAAAATGG - Intronic
983410862 4:167396101-167396123 TATTTTAAGCAAATGAATACTGG - Intergenic
983686371 4:170413778-170413800 CACTTTAAGGAAATGAAAACTGG - Intergenic
983695119 4:170518718-170518740 CAACTGAAGCAAAGAAAAAAAGG - Intergenic
984881310 4:184412216-184412238 GATTTTAAGCAAAAGCAAACTGG + Intronic
986449827 5:7852627-7852649 CATGTGAAGCAAAGGAAAAGGGG + Intronic
987004565 5:13696859-13696881 TAAAATAAGCAAAGGAAAAAGGG - Intronic
987173612 5:15284602-15284624 GAACTTAAGCAAAGAAAAAATGG + Intergenic
987237110 5:15953821-15953843 CATTTTAAGAAGAGGAAATTTGG + Intergenic
987285617 5:16453680-16453702 GAGTTTAAGCAAAGGAAAGGTGG - Intronic
987470966 5:18326960-18326982 CATTTTACCCAAAGTAAGAATGG + Intergenic
987495586 5:18639497-18639519 CATTTGAAGCAAACTAAATAAGG + Intergenic
987533117 5:19146710-19146732 CATTTTAAACTAAATAAAAAAGG + Intergenic
987555625 5:19443634-19443656 GATTTTCACCAAATGAAAAAGGG - Intergenic
987796695 5:22637432-22637454 CACTTTAAAGAAAGGAGAAAAGG + Intronic
988224189 5:28390860-28390882 AATTTTCAGGAAAGGAAAAGAGG - Intergenic
988376102 5:30437962-30437984 TATTTTAACCAAAGGAAAATTGG - Intergenic
988769403 5:34416167-34416189 CCTTTTAAGAAAAAGAAAAGCGG + Intergenic
988807630 5:34755091-34755113 CTTTACAAGCAAAGAAAAAAGGG - Intronic
989038626 5:37202450-37202472 ACTATTAAGAAAAGGAAAAATGG - Intronic
989629513 5:43466824-43466846 CATTTTAACTAAAGGAAGACAGG + Intronic
989788257 5:45358140-45358162 CCTTTTTAGCAACAGAAAAATGG + Intronic
989954152 5:50336695-50336717 CATTTTAAGGATAAGAAAATGGG - Intergenic
990072600 5:51803452-51803474 AATTATAAGGGAAGGAAAAATGG - Intergenic
990080870 5:51911972-51911994 GATTCTAAGCAAAGGACAGAAGG + Intergenic
990623379 5:57584508-57584530 AATTTTAAGCAAAGAAACAAGGG - Intergenic
990643535 5:57816434-57816456 CATTTTATACAAAGGAAATGGGG + Intergenic
990711608 5:58587404-58587426 TAATTTAAGAAAGGGAAAAATGG - Intronic
990925852 5:61021720-61021742 CATGGTATGCAAAGGTAAAAAGG - Intronic
991131429 5:63126499-63126521 CCTTCTAAGAAAAGGAAATATGG - Intergenic
991473797 5:66998697-66998719 AATATTAAGCAAAGGGAGAAAGG - Intronic
991557215 5:67909123-67909145 CAATCTTAGTAAAGGAAAAAAGG + Intergenic
991650860 5:68851770-68851792 CAATTCAAGAAAAAGAAAAAAGG + Intergenic
992079530 5:73221614-73221636 TATTTAAAGGAAAGGAGAAATGG + Intergenic
992092539 5:73330693-73330715 AATATTAAGCAAAGGAAAGCAGG - Intergenic
992201127 5:74384905-74384927 AGTTTTAAGCAAAGGAAGAAAGG + Intergenic
992343192 5:75847788-75847810 GATTTTAGAGAAAGGAAAAAAGG + Intergenic
992623308 5:78614684-78614706 CATGTTTAGAAAAAGAAAAAAGG + Intronic
992709404 5:79435301-79435323 AATTTTAAGAAAAGAACAAATGG + Intronic
993053944 5:82958479-82958501 CACCTTAAGAAAATGAAAAAAGG + Intergenic
993625438 5:90219269-90219291 CAATTTAAGAAAATGAAAGAAGG + Intergenic
993653898 5:90555097-90555119 CCTTTAAAGCAATGCAAAAATGG + Intronic
993835254 5:92812001-92812023 CATATTATTAAAAGGAAAAAGGG - Intergenic
993852823 5:93032470-93032492 CATTTTGAGCAAAAGTAATAAGG + Intergenic
993928397 5:93902020-93902042 TATTTGATGGAAAGGAAAAATGG + Intronic
994293339 5:98057196-98057218 CATTTTACAAAAATGAAAAATGG + Intergenic
994675796 5:102820528-102820550 TATTGGAAGCATAGGAAAAATGG + Intronic
994706050 5:103207894-103207916 CACTTCAAGAAAAGGAGAAATGG - Intronic
994799218 5:104349730-104349752 CACTTTATGCAAAGGCAAATTGG + Intergenic
994938471 5:106287974-106287996 AATTTGAAGCAAGGGAAAAATGG + Intergenic
995262741 5:110124168-110124190 CATTCTCAGCAAATGAACAATGG - Intergenic
995687558 5:114787486-114787508 CACTTTAGGAAAATGAAAAAGGG + Intergenic
995833303 5:116376971-116376993 CACTTTAGGCAAAGGAAATCTGG - Intronic
995867664 5:116708735-116708757 CACCTTCAGCAAAGGAAAAGTGG + Intergenic
995884684 5:116880873-116880895 CATTCTCAGGAGAGGAAAAAAGG + Intergenic
996083986 5:119285331-119285353 CATTTTAAGCATGGGAACCAGGG + Intronic
996667212 5:126073520-126073542 CATCTTAAACAAAAGAAAACAGG - Intergenic
996730092 5:126708705-126708727 CATTTTAATCAACATAAAAAGGG - Intergenic
996786901 5:127247635-127247657 CATTTTAGGCATTGGAAAATTGG + Intergenic
997777720 5:136626223-136626245 CAAATTAACCAAGGGAAAAATGG + Intergenic
997781717 5:136666356-136666378 CACTTTAAGAACTGGAAAAATGG - Intergenic
998502713 5:142647182-142647204 GCTTTTAAGCAAATGAGAAATGG - Intronic
998779859 5:145644666-145644688 CATTTAAAGCAACGCATAAAGGG - Intronic
999003516 5:147949690-147949712 CATTTAAACCAAAGGAAGAAAGG + Intergenic
999026791 5:148242655-148242677 CATTTTAAGCAAGGGAGAGCAGG + Intergenic
999649370 5:153750351-153750373 CATTTGAAGAAGAGGACAAAGGG + Intronic
999803618 5:155061185-155061207 TATTTTAAGCAAATGAACACAGG - Intergenic
999839397 5:155409022-155409044 CATTTTAAGAATAGGAAATTCGG + Intergenic
999876565 5:155813038-155813060 TTTTTTAAGAAAAGGAAGAAAGG + Intergenic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000134689 5:158336175-158336197 CATCTTAAGAAAAGGACCAAAGG - Intergenic
1000388930 5:160702410-160702432 CATTTTAAGCAAAACAACCACGG + Intronic
1000483138 5:161804770-161804792 TATTTTAAGCAAAGGGAGTATGG - Intergenic
1000739054 5:164942439-164942461 CAGTTTAAGGAAATAAAAAAAGG - Intergenic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001566475 5:172702685-172702707 GATTTTAAGCAGAGGAATGATGG - Intergenic
1001778134 5:174344525-174344547 CACTCTGAGCACAGGAAAAAGGG + Intergenic
1002837497 6:877402-877424 CATTTTCAGTACAGGAATAAGGG - Intergenic
1002979679 6:2124159-2124181 TCTTTTAAGGAAAGGAGAAATGG + Intronic
1003206221 6:4014847-4014869 CATTTAAAGAAAATGAACAAAGG - Intergenic
1003323684 6:5075593-5075615 CATTATAATGAAAGGAAGAATGG + Intergenic
1003725000 6:8751166-8751188 CAGTTTTATCACAGGAAAAATGG + Intergenic
1004144954 6:13057281-13057303 ATTTTTAAAAAAAGGAAAAAGGG + Intronic
1004757034 6:18621477-18621499 CATTTTAATCAAAGGAATAAAGG - Intergenic
1004767463 6:18746488-18746510 TATTTCAAGCAGAGGAAAGAAGG - Intergenic
1004969730 6:20896417-20896439 CATTTTATGCAACTTAAAAATGG + Intronic
1005591557 6:27334041-27334063 GATTTTAAGCAAAACAAAAACGG + Intergenic
1005623767 6:27644435-27644457 TTTTTTAATCAAAAGAAAAATGG + Intergenic
1005719007 6:28582418-28582440 TATTTAAAGCAAAGAGAAAAGGG + Intronic
1005750114 6:28874422-28874444 CATTTGAAGCACAGAAAAAAGGG - Intergenic
1006139196 6:31917603-31917625 AATTTTAAAAAAAGAAAAAAAGG + Intronic
1007192057 6:40027789-40027811 CATTTTAAAATAAGGAAATAGGG - Intergenic
1008020415 6:46570932-46570954 CATTTTGAGACAAGTAAAAATGG - Intronic
1008215906 6:48788406-48788428 TATTTTAAGCAAAAACAAAATGG - Intergenic
1008671172 6:53770551-53770573 GAATATAAGAAAAGGAAAAAGGG - Intergenic
1008871584 6:56278550-56278572 TATCTGAAGGAAAGGAAAAAAGG - Intronic
1008995586 6:57654624-57654646 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009184113 6:60553402-60553424 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009286258 6:61822019-61822041 TATTTTAAGAAAAGAGAAAATGG - Intronic
1009327582 6:62372785-62372807 ACCTTTAAGGAAAGGAAAAATGG + Intergenic
1009400365 6:63247414-63247436 AAGTGTAAGGAAAGGAAAAAAGG - Intergenic
1009887393 6:69640001-69640023 ATTTTTGAGGAAAGGAAAAATGG + Intergenic
1010166345 6:72919194-72919216 CATCTGAAGCCAAGGAAAGATGG + Intronic
1010405568 6:75501712-75501734 AATTTTAAGAAAAAAAAAAAAGG + Intergenic
1011011704 6:82710813-82710835 TATTTTAAACATATGAAAAATGG + Intergenic
1011093893 6:83637233-83637255 CCTTTTGAGCAAAGAAAACATGG - Intronic
1011146301 6:84221437-84221459 TTTTTTCAGCAAAGAAAAAACGG + Intronic
1011646679 6:89465550-89465572 CATTTTAAACAGAGGAAACTGGG - Intronic
1011842780 6:91522512-91522534 TATTTTAAGAAAAGAAAATATGG - Intergenic
1011965273 6:93149213-93149235 GATATTAAGCAAAGGGCAAATGG - Intergenic
1011976229 6:93302851-93302873 CACTTAAAGCACAGAAAAAAGGG + Intronic
1012165885 6:95951255-95951277 CCTTCTAAGCTAAGGAAAGAAGG + Intergenic
1012196790 6:96352300-96352322 AATTTCAAGCTAAAGAAAAATGG + Intergenic
1012196795 6:96352356-96352378 AATTTCAAGCTAAAGAAAAATGG + Intergenic
1012247598 6:96943234-96943256 CATTTTGAGGAAAAGAATAATGG - Intronic
1012289312 6:97433092-97433114 CATGGTAAACAAAGGACAAATGG + Intergenic
1012505728 6:99944176-99944198 CATTTTAGGGCCAGGAAAAAAGG + Intronic
1012698938 6:102427081-102427103 AATTTTAAGTAAAGGAATATTGG - Intergenic
1012904904 6:105052736-105052758 CATTATCAGCAATGAAAAAAGGG - Intronic
1013334597 6:109142613-109142635 AATTTTAAGAAAAAAAAAAAAGG + Intronic
1013341747 6:109221660-109221682 GGTTTTAAGAAAGGGAAAAAAGG - Intergenic
1013844435 6:114432923-114432945 AATTTGAAGGAAAGCAAAAAGGG - Intergenic
1014566293 6:122953168-122953190 CATTATTCGCAAAGGCAAAATGG + Intergenic
1014739660 6:125133801-125133823 CCTTTTAATCAAAGAAAAAAAGG + Intronic
1014764440 6:125390333-125390355 GATTTTACACAAAGGAATAAAGG - Intergenic
1015013712 6:128383515-128383537 AAATTTACACAAAGGAAAAAGGG - Intronic
1015375035 6:132500765-132500787 AATTTTAAACATAGGAATAATGG - Intronic
1015457425 6:133443069-133443091 AATTTTAAGAAAAGAAAATATGG - Intronic
1015634940 6:135265776-135265798 CCACTTAAGCAAAGGAGAAAGGG - Intergenic
1015709269 6:136121509-136121531 CTTTTTAAAAAAAGGAGAAAGGG + Intronic
1016072377 6:139755044-139755066 CATTTTTAGCCACGGAAAAGAGG - Intergenic
1016125774 6:140401025-140401047 CATATTAAATAAAGAAAAAATGG + Intergenic
1016318775 6:142819226-142819248 AATTTTAAAAAAAGAAAAAAGGG + Intronic
1016432444 6:144001262-144001284 CAATTTAAGCAATATAAAAATGG + Intronic
1016523622 6:144974875-144974897 CATTTAAAGCAATGTATAAAGGG - Intergenic
1017210374 6:151849021-151849043 TATTTCAAGCAAAGGGAAAAAGG - Intronic
1017315742 6:153029331-153029353 CATTTTAAGTTAAAGAGAAATGG + Intronic
1017555834 6:155567173-155567195 AATTTTAAGCAAATGAAGATTGG - Intergenic
1018042311 6:159935655-159935677 CATTTTTATGAAAGTAAAAATGG + Intergenic
1018076624 6:160222118-160222140 CATTTTACAGAAAGGAAAACAGG + Intronic
1018362911 6:163089434-163089456 TCTTTTAAGCCAAAGAAAAAGGG + Intronic
1018394158 6:163364512-163364534 CTTTTTTAGCAAAAGGAAAATGG + Intergenic
1018405024 6:163471266-163471288 CATTTTCAGATAAGGAAAAATGG + Intronic
1018989880 6:168666412-168666434 CCTTTTCAGCCAAGGAAACAAGG + Exonic
1020287166 7:6692852-6692874 AATTTTAAGCAAAAGCATAAAGG - Intronic
1020594561 7:10189797-10189819 TTCTTTAAGCAAAGGAAAATTGG - Intergenic
1020824936 7:13015783-13015805 AATTTAAAGGAAAGGAAGAAAGG - Intergenic
1021149016 7:17126662-17126684 CATTATGAGCAAAGGTAAAGAGG - Intergenic
1021383736 7:20002325-20002347 AATTATAATCAAAGGAAACAAGG - Intergenic
1022071770 7:26922961-26922983 AATTTTAAGAAAAAGAAAAAGGG + Intronic
1022601446 7:31764067-31764089 CATTTTAAGCAAAGGAAAAATGG + Intronic
1023085679 7:36568094-36568116 CATCTTAGGCTAAAGAAAAAGGG + Intronic
1023231713 7:38038870-38038892 CTTTATAAGCAAAGTGAAAATGG - Intergenic
1023403255 7:39806059-39806081 TTTTTTAATTAAAGGAAAAAGGG + Intergenic
1023513911 7:40981243-40981265 TCTTTCAAGAAAAGGAAAAAAGG - Intergenic
1023958814 7:44910026-44910048 AATTTTAAGGAAAAGGAAAAAGG - Intergenic
1024867785 7:53923474-53923496 CATTTTGAGCAATAGAAAAATGG - Intergenic
1024904790 7:54364786-54364808 AATTTTAAACAAAGGTAAATAGG - Intergenic
1024963089 7:54997774-54997796 CTGTTTAAGCAAAGAAAAGAGGG - Intergenic
1025192544 7:56907050-56907072 CATTGTCACCAAAGGAGAAAGGG + Intergenic
1025264522 7:57443894-57443916 TATTTTAAGCAGAGTCAAAAAGG + Intergenic
1025679402 7:63669872-63669894 CATTGTCACCAAAGGAGAAAGGG - Intergenic
1025791215 7:64688557-64688579 TATTTTAAGAAGAGGAAGAAGGG - Intronic
1026376247 7:69753983-69754005 CAGTTGAGGCAAAGGAAAACAGG - Intronic
1026424259 7:70274248-70274270 CCTTTTAAGGGAAGGAAAGAGGG - Intronic
1026429884 7:70334741-70334763 CATGTAAAACAAAGAAAAAATGG + Intronic
1026537269 7:71249567-71249589 TATTTTAATGAGAGGAAAAAAGG - Intronic
1026584275 7:71643502-71643524 CATTTTTACAAAAGGGAAAAAGG + Intronic
1026622172 7:71959427-71959449 CCTTTTGAGGAAAGGAAAATGGG + Intronic
1027545338 7:79520718-79520740 CATTTTAAGGAAAGAGCAAAGGG - Intergenic
1027557159 7:79679430-79679452 TATTTTAAGCACACTAAAAATGG + Intergenic
1027696753 7:81421481-81421503 CTTTTTAATAAAAGGATAAATGG + Intergenic
1027830291 7:83168648-83168670 CATTTTAATAAAAGGGAGAAAGG - Intergenic
1028053598 7:86216256-86216278 CCTTTTAAGAAAAAAAAAAAAGG - Intergenic
1028944451 7:96561274-96561296 CAGTTGAAGCAATGGAAAAGGGG + Intronic
1029411659 7:100416311-100416333 CACCTTAAGCAAAAGAAAGAAGG - Exonic
1030570600 7:111217545-111217567 TACTGTAAGCAAAGGAATAAAGG + Intronic
1030946602 7:115730305-115730327 CATTTTAATTAAACGGAAAATGG - Intergenic
1031070493 7:117156154-117156176 CATTCTGGGGAAAGGAAAAATGG - Intronic
1031611038 7:123827476-123827498 CAATTGAAGCAAAGGAAAGAAGG - Intergenic
1031794132 7:126149787-126149809 AATTTTCAGGATAGGAAAAATGG + Intergenic
1032768856 7:135027372-135027394 CATTTAAAACAAACAAAAAAAGG - Intronic
1032871834 7:135994149-135994171 GATTATAAGCAAACAAAAAAAGG - Intergenic
1032999371 7:137486350-137486372 AATTTTAAAAAAAGGTAAAAAGG + Intronic
1033440894 7:141377667-141377689 CATCTTAAAAAAAGAAAAAAGGG + Intronic
1033933986 7:146559978-146560000 CATTTTAAATACAGAAAAAATGG - Intronic
1033935605 7:146581650-146581672 CATTTTTAGCAAAAAAAAAAAGG + Intronic
1034966075 7:155391816-155391838 CATCCTAAGCATTGGAAAAAAGG + Intronic
1035091140 7:156312193-156312215 CATCTCAATCAATGGAAAAAGGG - Intergenic
1035415771 7:158684336-158684358 GATTTTAAGAAAAGGAAAGGAGG + Intronic
1036496213 8:9272133-9272155 CATTTTGAGCAATTTAAAAAAGG + Intergenic
1037658818 8:20909928-20909950 CCTTTAAGGCAAAGCAAAAAGGG + Intergenic
1038101199 8:24378071-24378093 CATTCTCAGCAAAGTAAAACAGG + Intergenic
1038185406 8:25269216-25269238 CATTGGAAGTAAAGGACAAAGGG - Intronic
1038547969 8:28440572-28440594 CCTTTTGAGTGAAGGAAAAAAGG + Intronic
1038564760 8:28610473-28610495 CATTTGGACCAGAGGAAAAAGGG + Intronic
1038823768 8:30978344-30978366 CACTTTGTGCAAAAGAAAAATGG - Intergenic
1039073298 8:33665597-33665619 CATTTTAAACAAAGGAAAAGTGG + Intergenic
1039262201 8:35783765-35783787 AATTTTATGAAAAGGAAAAGTGG - Intronic
1040758227 8:50806869-50806891 TATTTCAAGCAAAGGTAAAAAGG - Intergenic
1041063191 8:54056414-54056436 CATATCAACCAAAGCAAAAATGG + Intronic
1041291582 8:56313104-56313126 CATTTTAAGAAGAGAAAAATGGG - Intronic
1041441634 8:57903503-57903525 CAAATTAAGAAAAGGAAAAAAGG + Intergenic
1041654137 8:60331582-60331604 CTTTTTAATAAAAAGAAAAATGG + Intergenic
1041681317 8:60595563-60595585 AATATTAATCAAAGGAAAACAGG + Intronic
1041864185 8:62550227-62550249 CATATTTATCAAAGGAAAAAAGG - Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043261749 8:78209154-78209176 CTGTTTAAGCAAATGCAAAATGG + Intergenic
1043661962 8:82754687-82754709 TATTTTAAGAATATGAAAAAGGG + Intergenic
1043664291 8:82788546-82788568 CATTTTAAGCAATGGAGCTAGGG + Intergenic
1044038826 8:87339688-87339710 CACAGTAACCAAAGGAAAAAAGG - Intronic
1044084189 8:87923394-87923416 TATTTTATCCAAAGGAAAATTGG + Intergenic
1044680219 8:94770186-94770208 AATTTTCAGCAAAATAAAAAAGG - Intronic
1044802058 8:95967132-95967154 AATTTTAAGTAAACTAAAAAAGG - Intergenic
1044911276 8:97062190-97062212 CCTTTAAACCAAAGCAAAAATGG - Intronic
1044982217 8:97728254-97728276 CAATTTAAACAAATCAAAAATGG - Exonic
1045271376 8:100664663-100664685 CATTTCAAGAAAAGGAAAGTGGG - Intergenic
1045317571 8:101056585-101056607 CATATTTTCCAAAGGAAAAATGG + Intergenic
1045400785 8:101815328-101815350 GATTTTTGGCAAAGGAGAAAAGG + Intronic
1045410526 8:101912797-101912819 GATTTTCAGCAAACGAAATATGG + Intronic
1045934765 8:107666396-107666418 AATTTTAAACAAAAGGAAAATGG - Intergenic
1046345300 8:112917038-112917060 CTTTATAAACAATGGAAAAATGG - Intronic
1046592396 8:116221918-116221940 AATTTTAAACAAAGTAAAACAGG + Intergenic
1046754441 8:117958835-117958857 CATATTTAGGAAAGAAAAAAAGG - Intronic
1046882207 8:119321380-119321402 CATTTTAGGCAAAAAGAAAAGGG + Intergenic
1046928042 8:119814582-119814604 CATTTCAAGTAAAATAAAAAAGG + Intronic
1047474600 8:125214534-125214556 AATTCTAAGCAGAGGCAAAAGGG - Intronic
1047557878 8:125952233-125952255 CATTTCAAGCAGAAGGAAAATGG - Intergenic
1047948138 8:129903351-129903373 CTGTTTAAGGAAAGAAAAAAAGG + Intronic
1048161650 8:132027004-132027026 TATTCCAAGCAAAGGGAAAAGGG - Intronic
1048213606 8:132477236-132477258 CATTTGAGGCAAAAGAAACAAGG + Intronic
1048299544 8:133241113-133241135 CAGTTTAAGGAAATGATAAAAGG + Intronic
1048548421 8:135408347-135408369 GAATTTAAGCAAAGGAAGGAGGG - Intergenic
1048939802 8:139389529-139389551 CATATTAACCAAAAGAAAACTGG + Intergenic
1049991049 9:992054-992076 CATTGAAAACAAAGTAAAAATGG + Intergenic
1050041331 9:1496887-1496909 CAGTTGAAGGAAAGGAAGAAAGG - Intergenic
1050810126 9:9734766-9734788 CCATTAAAACAAAGGAAAAAAGG + Intronic
1050869488 9:10549360-10549382 GCTTTTAACTAAAGGAAAAAAGG + Intronic
1051522715 9:18007990-18008012 AATTTTAAGCTAAGGAATAAGGG - Intergenic
1051902344 9:22057417-22057439 TATTTTAAGCCAAAGAATAAAGG + Intergenic
1052113911 9:24625308-24625330 CATTTTAGACTGAGGAAAAAAGG - Intergenic
1052668287 9:31522198-31522220 CTTTCTAAGAAAATGAAAAATGG - Intergenic
1052964316 9:34328369-34328391 TATTTTAAGCAAAGACTAAAAGG + Intronic
1053488135 9:38477508-38477530 CATTTTGAGACAAAGAAAAATGG + Intergenic
1053811737 9:41860281-41860303 GATTTTAACCAAAGAAAACAGGG - Intergenic
1054618857 9:67327158-67327180 GATTTTAACCAAAGAAAACAGGG + Intergenic
1055119762 9:72645820-72645842 CATTATTAACTAAGGAAAAATGG - Intronic
1055323616 9:75105930-75105952 AAGTATAAGCAAAGAAAAAATGG + Intronic
1055386192 9:75764416-75764438 CATCTTAAGTAAAGGAGCAAGGG + Intergenic
1055407516 9:75990052-75990074 CATTTGAACAAAAGGTAAAAAGG - Intronic
1055444742 9:76371311-76371333 CATTTCAAAAAAAGAAAAAAAGG + Intergenic
1055940667 9:81646287-81646309 AAATTTAACCAAAGGAGAAACGG + Intronic
1056087600 9:83167198-83167220 CAATTTAGGCAAAGTAAATAAGG + Intergenic
1056425603 9:86472644-86472666 CATTTTAAAAAAAAGAAAAGTGG - Intergenic
1056455874 9:86759331-86759353 CAAATGAAGAAAAGGAAAAAAGG + Intergenic
1057098321 9:92332802-92332824 CATTTAAAACAAAAAAAAAAAGG + Intronic
1057465183 9:95307172-95307194 CATTTTAAAAAAAGAAAAACAGG - Intronic
1057668496 9:97066781-97066803 CATTTTGAGACAAAGAAAAATGG + Intergenic
1057847678 9:98538196-98538218 CATTTTACACAAGGGAAAAGTGG + Intronic
1058071560 9:100605851-100605873 CATTACAAACAAAGGAAAAAAGG - Intergenic
1058161565 9:101575572-101575594 CATTTAATGCAAAGAAAATAAGG - Intronic
1058240660 9:102553762-102553784 AATTTCAACCAAAAGAAAAATGG - Intergenic
1058368770 9:104239834-104239856 CATTATAAGAAAAGGAAAATGGG + Intergenic
1058920505 9:109609972-109609994 GAGATTAAGGAAAGGAAAAAAGG - Intergenic
1059698808 9:116755415-116755437 CCTTTTAAGAAGAGGAAAACTGG + Intronic
1059796166 9:117699329-117699351 GCTTTTAAGCAAAGGCATAAAGG - Intergenic
1060085635 9:120697963-120697985 CAGTTTAATCAAAGGAAAAAAGG + Intronic
1060278009 9:122196835-122196857 GATAATAAGCAAAAGAAAAAAGG - Intronic
1060637724 9:125212588-125212610 CACTTAAACCAGAGGAAAAAGGG + Intronic
1060704574 9:125786438-125786460 CATTTGAATGAAAAGAAAAAGGG + Intronic
1061170698 9:128951668-128951690 AATGTTAAGCAAAGAAAAGAAGG + Intronic
1061643031 9:131974673-131974695 CATTTCAGGCAAATGAACAAAGG - Intronic
1061665356 9:132157735-132157757 CACTTTACCCAAATGAAAAATGG - Intergenic
1062199800 9:135296490-135296512 CCATTTTAGCAAAGGAAAAGGGG + Intergenic
1186019843 X:5242167-5242189 TATTTCAAGCAAATGAATAAGGG + Intergenic
1186388633 X:9135628-9135650 CATTGGTAGCAAAGGAAAATTGG + Intronic
1186586824 X:10884103-10884125 CATTTTCAGCAAATGAAATTTGG + Intergenic
1187182686 X:16958020-16958042 CATTTTGAAGAAAGCAAAAACGG + Intronic
1187524939 X:20045722-20045744 CATTTTGGGAAAAGGACAAAAGG + Intronic
1188322907 X:28761816-28761838 AATTTTGAGAAAAGAAAAAACGG + Intronic
1188991361 X:36824510-36824532 TATTATAAGCAAAGTACAAATGG + Intergenic
1189494399 X:41496072-41496094 GTTTTTAAGCAAAGAAGAAATGG + Intergenic
1189707440 X:43773033-43773055 TATTTTAAGCAATGCAAGAATGG + Intronic
1189972089 X:46428282-46428304 CATTATAAGGAAAGGTTAAAAGG - Intergenic
1190359988 X:49639669-49639691 AATTTTAAGAAAAGGAGACAAGG - Intergenic
1190798452 X:53766714-53766736 AATTTTAAAAAAAGGACAAAGGG + Intergenic
1191138491 X:57091997-57092019 ATTTTGAAGCAGAGGAAAAATGG + Intergenic
1191865437 X:65699931-65699953 CATTTTAAAGAAGGGAGAAATGG - Intronic
1192270800 X:69577581-69577603 CATGTTAAGCATAGGCAAAGGGG - Intergenic
1192418303 X:71004606-71004628 TACTTTAAGCAAACAAAAAAGGG + Intergenic
1192921153 X:75707752-75707774 CATCTTAAACAAAGGAAAATAGG - Intergenic
1193177866 X:78415867-78415889 CAAATTAGGCAAAGCAAAAAAGG + Intergenic
1193653346 X:84167072-84167094 ACTTTAAACCAAAGGAAAAATGG + Intronic
1193864701 X:86716995-86717017 CATTTTATGCTAAAGAGAAATGG + Intronic
1194124761 X:90002425-90002447 CATGTTCATCAATGGAAAAATGG - Intergenic
1194165479 X:90509122-90509144 AATTTTAAGAAAATGAACAAAGG + Intergenic
1194557837 X:95384145-95384167 AATTTGAAACAAAGGATAAAGGG + Intergenic
1194620782 X:96168575-96168597 TATTTAAGGCAGAGGAAAAAAGG + Intergenic
1194809059 X:98368072-98368094 CAATGAAAGCAAAGGAAATAAGG + Intergenic
1195042450 X:101026906-101026928 CATTTTAAGCAGAATAAAAAAGG + Intronic
1195364581 X:104113970-104113992 GATTCTAAGGAAAGTAAAAAAGG - Exonic
1195528151 X:105918351-105918373 TAAGTTAAGCAAGGGAAAAATGG + Intronic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195868691 X:109462750-109462772 TATTTTAATCAAAGGATCAAAGG - Intronic
1197161133 X:123323472-123323494 AATTATAAGCAATGGAGAAATGG - Intronic
1197466931 X:126816368-126816390 TATTTGAAGCAAAAGAGAAAGGG + Intergenic
1198408109 X:136336652-136336674 AAGTTTAAGGAAAGTAAAAATGG - Intronic
1198556451 X:137798618-137798640 CATCTTAAACAACGGAAAACAGG + Intergenic
1198824304 X:140683118-140683140 CATCTTAAACAAAAGAAAAGAGG - Intergenic
1198857292 X:141031987-141032009 CATCTTAAACAAAAGAAAACAGG + Intergenic
1198905403 X:141555379-141555401 CATCTTAAACAAAAGAAAACAGG - Intergenic
1199031949 X:143011348-143011370 CATTTTAAGCAACAAAAACAAGG - Intergenic
1200383909 X:155869599-155869621 CATTTTAAGAATATGACAAAAGG - Intergenic
1200477651 Y:3660035-3660057 CATGTTCATCAATGGAAAAATGG - Intergenic
1200511745 Y:4086932-4086954 AATTTTAAGAAAATGAACAAAGG + Intergenic
1200852066 Y:7893529-7893551 CATTTTAAGTAATGGAGACATGG + Intergenic
1201231798 Y:11871959-11871981 CATTCTAAGCAAATGAATACAGG - Intergenic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic
1201749461 Y:17416873-17416895 AACTTTAAGCAAAGTGAAAAGGG + Intergenic
1201967961 Y:19758844-19758866 CATCTTAAACAACGGAAAACAGG - Intergenic