ID: 1022603646

View in Genome Browser
Species Human (GRCh38)
Location 7:31786484-31786506
Sequence TAGAAGTTGAATAAATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 475}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022603645_1022603646 0 Left 1022603645 7:31786461-31786483 CCTTTAGCAGTGTGCTTGGCATA 0: 1
1: 0
2: 3
3: 44
4: 240
Right 1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG 0: 1
1: 0
2: 0
3: 39
4: 475
1022603643_1022603646 23 Left 1022603643 7:31786438-31786460 CCTGCATATACTTAGAAGATAAG 0: 1
1: 0
2: 0
3: 18
4: 154
Right 1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG 0: 1
1: 0
2: 0
3: 39
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022603646 Original CRISPR TAGAAGTTGAATAAATTTTC AGG Intronic
902076465 1:13790678-13790700 TAGAAGTTGAATACGGTTTGAGG + Intronic
903335233 1:22620135-22620157 TAAAAGTTGAATAAATTGAAAGG - Intergenic
903492457 1:23739823-23739845 GACAAGTTAAAAAAATTTTCAGG - Intergenic
903979695 1:27176901-27176923 AAGAAGATGAAGAAGTTTTCAGG + Intergenic
905096814 1:35479244-35479266 TAAAAGTTACATAATTTTTCAGG + Intronic
905983086 1:42249460-42249482 AAGAAGTGAAATAAGTTTTCTGG + Intronic
906184038 1:43846920-43846942 TAGAAGTTCTCTATATTTTCTGG - Intronic
907799032 1:57746126-57746148 TAGGACTGCAATAAATTTTCTGG + Intronic
908932986 1:69340015-69340037 TAAAAGTTTAAAAAATTTGCAGG + Intergenic
909322854 1:74312050-74312072 TAGAAGATGAACAGCTTTTCTGG + Intronic
909684174 1:78327862-78327884 TATAAGATGAATAAGTTTTGGGG + Intronic
910136379 1:83976190-83976212 TAGAAAATGAATAACATTTCTGG - Intronic
910841454 1:91565910-91565932 TAAAAGCTGAATAAAATTTTAGG + Intergenic
910971520 1:92860810-92860832 TAGAACTTTAATAAGTTTACAGG + Intronic
911321948 1:96425173-96425195 TTGTTTTTGAATAAATTTTCAGG - Intergenic
911466207 1:98256423-98256445 GAGGAGTTTAATAAGTTTTCTGG - Intergenic
911773678 1:101780210-101780232 AAGAAATTTAGTAAATTTTCAGG - Intergenic
912574733 1:110657501-110657523 TAGAAAGTGAATAAATATTCTGG + Intergenic
915099625 1:153490004-153490026 TAGAACTTTAATAAATTTGAAGG - Intergenic
915338622 1:155163420-155163442 TAAAAGTTAAATCAATTTTATGG - Intergenic
915983445 1:160438556-160438578 TAGAAGTGGCATAAAATCTCAGG - Intergenic
916872287 1:168928838-168928860 TAGCAGTTTAAGAAATTTTTGGG - Intergenic
917034397 1:170731250-170731272 TAGAAGTTGCAGAAAGTCTCGGG - Intronic
918157441 1:181862903-181862925 GAGAAGATGAAAAAATGTTCTGG + Intergenic
918570701 1:185988599-185988621 TAGAAGTTTAATGCATTTTAAGG + Intronic
918847448 1:189636447-189636469 TAGTAGCTCAATAAATTTACTGG - Intergenic
919104336 1:193129988-193130010 AACATGTTTAATAAATTTTCAGG + Intronic
919134121 1:193487664-193487686 TAGTAGATCAAAAAATTTTCGGG + Intergenic
919556936 1:199068542-199068564 TAAAAAAAGAATAAATTTTCAGG + Intergenic
919878331 1:201886643-201886665 AAGAAGTTGTCTAAATCTTCAGG - Intergenic
919953721 1:202391270-202391292 TTGATGTTGAATATCTTTTCAGG - Intronic
921610005 1:217201213-217201235 TAGTAGGTGTATATATTTTCAGG + Intergenic
922018804 1:221682667-221682689 TAGAAGTTTAAAGAATATTCTGG - Intergenic
922366331 1:224867710-224867732 AAGAAGATGAGTAAATTTTGTGG + Intergenic
922944472 1:229500093-229500115 TAGAATTTTAAAAAATATTCTGG + Intronic
923607594 1:235458609-235458631 TAGAAGTTCAATAATTTTGCAGG + Exonic
924037466 1:239952268-239952290 TAAAAGTTCATTATATTTTCTGG - Intergenic
924038740 1:239962683-239962705 TAGAAGTAAAATAAAAATTCAGG + Intergenic
924395787 1:243619239-243619261 TAATAGTTGTATACATTTTCGGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064133338 10:12729753-12729775 TAGAGGTTGCAGATATTTTCAGG + Intronic
1064410488 10:15099792-15099814 TAAAAATTAAAAAAATTTTCTGG + Intronic
1064698673 10:17994348-17994370 TAGAAATTGTATAAACTTTTAGG + Intronic
1064724200 10:18260972-18260994 AAGAAGTAGCATTAATTTTCCGG - Intronic
1065112929 10:22457787-22457809 TAAAAGCTGTATAAATCTTCCGG - Intergenic
1066184915 10:33000249-33000271 AACAACTTCAATAAATTTTCAGG - Intronic
1067169694 10:43896603-43896625 TAGCAGTTGTATTAATTTTGAGG + Intergenic
1067495647 10:46757828-46757850 TAGGAGTTGAAACAGTTTTCTGG - Intergenic
1067599005 10:47582560-47582582 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1067948668 10:50709145-50709167 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1068242993 10:54328876-54328898 TGGAAGTTTAATAAAATTTCTGG - Intronic
1068301169 10:55142477-55142499 TATAAGTTAAATATATTTTCAGG + Intronic
1068665434 10:59670308-59670330 GAGAGGCTGAATAATTTTTCAGG + Intronic
1069666450 10:70164041-70164063 AAGAAGTTGATTAAATGATCAGG + Intronic
1070266923 10:74912209-74912231 TAGGAGTTGAAGAAATGTTTAGG - Intronic
1070376355 10:75834953-75834975 TAGAAGTTGGAAGAATTTTGAGG - Intronic
1070883988 10:79874142-79874164 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1071446266 10:85751000-85751022 TAACAGTTGAAGAAATGTTCAGG + Intronic
1072316994 10:94212835-94212857 TAGATGCTCAATAAATATTCTGG - Intronic
1072853502 10:98922577-98922599 TATACGTGGAATTAATTTTCTGG + Intronic
1075068773 10:119307178-119307200 GAGAGGTTGAGTAAATTTCCTGG + Intronic
1075215980 10:120535413-120535435 CAGATGGAGAATAAATTTTCAGG - Intronic
1076397031 10:130146858-130146880 TAGTAGGTGATAAAATTTTCAGG + Intronic
1076399558 10:130172619-130172641 TACAGGTTGAATACAATTTCAGG + Intronic
1076448526 10:130537427-130537449 AAGAACTTAAATAAATTTACAGG + Intergenic
1078878818 11:15427125-15427147 TAAAAGATGAAGAAATTTACTGG + Intergenic
1078981978 11:16545987-16546009 AAGAAGTTCAATAAAGTTGCAGG + Intronic
1078997670 11:16720889-16720911 TCGAAGTTGAGAAAATTTTAAGG + Intronic
1079310023 11:19356930-19356952 TAGAAGTTGAACAATGATTCAGG + Intronic
1079539489 11:21555151-21555173 TAGATGTTAAATAAATATGCAGG + Intronic
1079996633 11:27302017-27302039 TAGAAGTCGTAAATATTTTCTGG + Intergenic
1079997917 11:27315734-27315756 TTGAATTTGTATAAATTTGCAGG + Intergenic
1080064171 11:27990573-27990595 TTTAATTTGAATAAATTTACAGG - Intergenic
1080545411 11:33312393-33312415 TAGAAGTTGATTAATTTTGTTGG + Intronic
1081305313 11:41504764-41504786 TACAAGATGAATAAATTCTGAGG - Intergenic
1082022783 11:47548887-47548909 TAGAAGTTCTTTATATTTTCTGG - Intronic
1082676177 11:56105717-56105739 CTGAAGTGGAATTAATTTTCAGG - Exonic
1082677419 11:56123047-56123069 CTGAAGTGGAATTAATTTTCAGG - Exonic
1082690021 11:56290369-56290391 CTGAAGTGGAATTAATTTTCAGG + Exonic
1082890893 11:58137499-58137521 TATAAGTTAAATAAATTTTTTGG - Intronic
1083013177 11:59423732-59423754 TATAATTAGAATAAATGTTCTGG - Intergenic
1084278626 11:68071113-68071135 TAGTAGTTCAATAAAATTTAAGG - Intronic
1085865207 11:80282597-80282619 TACAAGTTACAGAAATTTTCTGG + Intergenic
1086034713 11:82402666-82402688 TAGATGTTTAATAAAATCTCTGG + Intergenic
1086090920 11:83003895-83003917 CAAATGTTGAATAAATTTTGAGG - Intronic
1086291060 11:85309749-85309771 AAAAAGTAGAAGAAATTTTCAGG - Intronic
1086859700 11:91910578-91910600 AAGAATTTGAATAGAATTTCAGG - Intergenic
1087379224 11:97383506-97383528 TAGAAATTACCTAAATTTTCTGG - Intergenic
1087470226 11:98564676-98564698 TAGTAGTCCAATAAATTGTCAGG - Intergenic
1087584207 11:100097423-100097445 TAGAAAAAGAATAAGTTTTCTGG + Intronic
1090230045 11:125095805-125095827 TAATAGTTGAATAACTTTTGGGG + Intergenic
1090818440 11:130318737-130318759 TAGAAGAGGTATAAATTTTAGGG - Intergenic
1091429823 12:424270-424292 TAGAAGTTCATTATATATTCTGG + Intronic
1092309946 12:7341934-7341956 TAGAAGTTCAACAAATTTCTTGG - Intergenic
1093128784 12:15364245-15364267 TAGAAGTTTAGTTTATTTTCTGG - Intronic
1093206176 12:16253402-16253424 TAGAAGTTCATTATATATTCTGG - Intronic
1093217882 12:16384237-16384259 TAGAAGTTGGATACATTTTGGGG - Intronic
1093442878 12:19220049-19220071 TAAAAGTTGAATTAATTGTATGG - Intronic
1093969744 12:25364172-25364194 TACAAATGGAATATATTTTCTGG + Intergenic
1096350574 12:50896426-50896448 TAGAAGTTGTTTAAATATTTGGG - Intergenic
1097387831 12:58971127-58971149 GAGAAGTTGAAGAGATTTTGAGG + Intergenic
1098277334 12:68826325-68826347 TAAAAATTGATTAAATTTTTCGG + Intronic
1098376071 12:69816738-69816760 TACAAATTGATTAACTTTTCTGG - Exonic
1098754876 12:74348742-74348764 AAAATGTTGAACAAATTTTCAGG + Intergenic
1099013777 12:77322397-77322419 TAGCAGCTCAATAAATGTTCAGG - Intergenic
1099195664 12:79612573-79612595 AATAAGTAGAATAATTTTTCTGG - Intronic
1099340603 12:81427892-81427914 GAGAAGTTGAATTAATTGCCAGG + Intronic
1099561246 12:84176546-84176568 TAGAATTTGAATTCATTTACTGG - Intergenic
1099631386 12:85149821-85149843 TAGTAGTTAAATAATTGTTCTGG + Intronic
1099743030 12:86665669-86665691 TAAAAGTTGTATAACTTTTCCGG - Intronic
1100207021 12:92361583-92361605 CTGAAATTGAATAATTTTTCTGG - Intergenic
1100814891 12:98377023-98377045 TAGAAGTTTAAAAGCTTTTCAGG - Intergenic
1100841778 12:98620219-98620241 TAGGAATTTAATAAATATTCTGG - Intronic
1100916245 12:99426650-99426672 AAGAAGATGGAAAAATTTTCTGG - Intronic
1101137221 12:101756744-101756766 TTGGGGATGAATAAATTTTCAGG - Intronic
1101771846 12:107759492-107759514 TTGAAATTAAATAAATATTCAGG - Intronic
1101891790 12:108723141-108723163 TAGATGGTGAATTAATTTTGTGG - Intronic
1102281096 12:111619577-111619599 TAGAAGGTGTATATATTTACGGG + Intergenic
1103603082 12:122066471-122066493 TACATGTTGATTAAATATTCAGG - Intergenic
1106502476 13:30342303-30342325 TAGAAGTTCAATAACTTGCCCGG + Intergenic
1106873096 13:34043030-34043052 AAGAAGTTGTAATAATTTTCTGG + Intergenic
1107219156 13:37960666-37960688 TAGCAGTTGGAAAAATTATCTGG + Intergenic
1107817563 13:44257628-44257650 TACAACATGAATAAATTTTAAGG - Intergenic
1109250197 13:60010416-60010438 TAGAATTTAAATAAATGTTGAGG - Intronic
1109561037 13:64050503-64050525 TAGAAATTCTAGAAATTTTCTGG - Intergenic
1109692589 13:65912351-65912373 TAGAAGATGGAGAAATTTTGTGG - Intergenic
1110433709 13:75456431-75456453 TAGAAGTTCTTTAAATATTCTGG - Intronic
1110653357 13:77968897-77968919 TTGAAGTTGGACAAATATTCAGG + Intergenic
1110658297 13:78026994-78027016 TAGTAATTGGATAAATTTTATGG + Intergenic
1111078446 13:83269510-83269532 TAAAAGTTGACTATATTTTGTGG - Intergenic
1111106751 13:83655072-83655094 TAGATTTTAAATAAGTTTTCTGG - Intergenic
1111238080 13:85434709-85434731 TTGAAGTTAAATGATTTTTCAGG + Intergenic
1111290535 13:86162867-86162889 TAGCAGTTGATTAAATGTTCAGG - Intergenic
1111390921 13:87593579-87593601 TAGTAGGTGTATAAATTTGCGGG - Intergenic
1111606716 13:90547937-90547959 TAAAAGTTTGAAAAATTTTCAGG - Intergenic
1111613774 13:90639264-90639286 TAAAAATTAAATAAAGTTTCTGG + Intergenic
1112056577 13:95694115-95694137 AGGAAGTTGAATAATTTTTTAGG - Intronic
1112550171 13:100412066-100412088 TAGAATTTGAATAGAGTTTGTGG + Intronic
1112947432 13:104948170-104948192 CAGAAGTCAAATAGATTTTCAGG - Intergenic
1114341591 14:21751039-21751061 TGGAAGTTAGATGAATTTTCTGG + Intergenic
1114369042 14:22065169-22065191 TAGTAGTTGTATATATTTTAGGG - Intergenic
1115894323 14:38067773-38067795 TAAAAGTTGAATATATCTGCAGG - Intergenic
1116192952 14:41683586-41683608 AACAAGTTCAATAAAGTTTCAGG + Intronic
1116221394 14:42092645-42092667 TAGAACATGAATATATTTTGGGG + Intergenic
1116232623 14:42236198-42236220 TAGAACTTCAATAAATTTGAGGG + Intergenic
1116274163 14:42808773-42808795 TAGAAATAGTATAAATATTCGGG - Intergenic
1117028838 14:51649918-51649940 TAAAAAATAAATAAATTTTCCGG - Intronic
1117153524 14:52913777-52913799 TAGATGTTGAGAAGATTTTCAGG - Intronic
1117702860 14:58432330-58432352 TTAAAGTTTAATAAATATTCAGG + Intronic
1120281021 14:82437921-82437943 TAGGAGTAGAACAAATTTTAAGG + Intergenic
1120902129 14:89584623-89584645 TATAATATGAATATATTTTCAGG + Intronic
1120991112 14:90378182-90378204 TGGAAGTTGAACTCATTTTCTGG - Intergenic
1202836604 14_GL000009v2_random:81966-81988 AAGAAGTTGAATATCTTTTCTGG - Intergenic
1123496474 15:20832203-20832225 AAGATGTTGAATATCTTTTCTGG + Intergenic
1123553711 15:21405793-21405815 AAGATGTTGAATATCTTTTCTGG + Intergenic
1123589954 15:21843158-21843180 AAGATGTTGAATATCTTTTCTGG + Intergenic
1125206938 15:37163963-37163985 TACAAGTTGAACAAAATTTTTGG - Intergenic
1125277598 15:38009919-38009941 TAGAACATGAATAATTTTTGGGG - Intergenic
1125994249 15:44142592-44142614 TAGATTTTAAAGAAATTTTCTGG - Intronic
1126393030 15:48179134-48179156 TAGGAGTTGATTAAATTTAACGG - Intergenic
1126506470 15:49409718-49409740 AAGAAGTGGAATAAAATTTGAGG - Intronic
1126972610 15:54134160-54134182 TATAAGATGAATAAATTCTGGGG - Intronic
1127793843 15:62421812-62421834 TAAAAGTTAAATAAAATTACAGG + Intronic
1130733470 15:86523481-86523503 TAGAACTTGAATACATCTTTTGG + Intronic
1131678562 15:94697729-94697751 TAGATGCTCAATAAATTTTGTGG + Intergenic
1202962055 15_KI270727v1_random:132989-133011 AAGATGTTGAATATCTTTTCTGG + Intergenic
1133676340 16:8076347-8076369 TAGAAGTTGCTTCAATTTTAAGG - Intergenic
1134183534 16:12065889-12065911 AACAAGTTGCTTAAATTTTCGGG + Intronic
1135185490 16:20311949-20311971 GAGAGGTTTAATAACTTTTCTGG - Intronic
1137354353 16:47745348-47745370 TAGAACTTGAATCAACTTTGAGG - Intergenic
1138475298 16:57267220-57267242 TAGAACTTGAACATATTTTGGGG - Intronic
1138741036 16:59310467-59310489 TAGAAATATAATAAATTTACTGG - Intergenic
1138756255 16:59489631-59489653 TAGAAGTTACTTGAATTTTCAGG - Intergenic
1138925745 16:61589277-61589299 TAGAAGTTATATAGAATTTCAGG - Intergenic
1142932531 17:3299120-3299142 GTGAAGATGAATAAATTCTCTGG - Intergenic
1147519756 17:41159661-41159683 TAAATCTTAAATAAATTTTCAGG - Exonic
1148528632 17:48367319-48367341 TATAAGATGAATAAATTCTGAGG + Intronic
1149025320 17:52020645-52020667 TAGAAGTTGAATAAAAGTTATGG - Intronic
1149025374 17:52021115-52021137 TAAAAGTTGAATAAAAGTTATGG + Intronic
1149235771 17:54588907-54588929 AAGAAGTTAAACAAATTTACAGG - Intergenic
1149584812 17:57779087-57779109 TAGAAGTTAAATAAATTATGAGG + Intergenic
1149620829 17:58043803-58043825 TAGAAGTAGAATTAATTGTGAGG + Intergenic
1150203789 17:63384759-63384781 TAGGAGTAGAAGAAATTGTCTGG + Intronic
1151737391 17:75952592-75952614 TAAAAGTTAATTAAATTTTAAGG - Intronic
1153938579 18:9954968-9954990 AAGGAGTTGATTAAATTTTAAGG + Intronic
1154291292 18:13110020-13110042 TATAAGGTGTATAAATTCTCAGG - Intronic
1154367891 18:13727483-13727505 TAGAAGTTGCACATATTTGCAGG + Intronic
1155719930 18:28999332-28999354 AAGATGTTGAATAATTTTCCAGG + Intergenic
1155816822 18:30322170-30322192 TAAAATTTTAATAAATTCTCAGG + Intergenic
1156408877 18:36808670-36808692 TAGACATTGCATAAGTTTTCTGG - Intronic
1157212075 18:45751899-45751921 TAGAAGTGGAAAAAATCTTCAGG - Intronic
1157367346 18:47077479-47077501 TAAATTTTGAATACATTTTCAGG + Intronic
1157870200 18:51222990-51223012 TGGAAGTTAAAAAAATTTACTGG - Intergenic
1158006442 18:52677381-52677403 AAAAACTTGAAAAAATTTTCAGG + Intronic
1158494782 18:57944897-57944919 TAAAAGTTCAATAAAATGTCTGG + Intergenic
1159387916 18:67750260-67750282 AATAAGTGGAAGAAATTTTCTGG - Intergenic
1159467705 18:68805824-68805846 GAGAAGTTGAATATGTTTTCAGG - Intronic
1159546832 18:69850068-69850090 TAGAAGTTTGAAAAATGTTCAGG + Intronic
1159822154 18:73159092-73159114 TAGAAATTGGAAAAATTGTCAGG + Exonic
1162720438 19:12658730-12658752 TAAAAGTTTAGTAAAATTTCAGG - Intronic
1164786985 19:30941266-30941288 TAGAAGTTGAAGTAACTCTCAGG + Intergenic
1165535953 19:36444869-36444891 CAGAACTCTAATAAATTTTCAGG + Intergenic
1167855436 19:52234353-52234375 TAGAGGTTGAATAAACATTAAGG + Intergenic
1202636032 1_KI270706v1_random:45396-45418 AAGAAGTTGAATATCTTTTCTGG + Intergenic
925753932 2:7115599-7115621 TAGAGGTTGAATTCATTTTGTGG + Intergenic
925790020 2:7475170-7475192 TAGAAGTAAAAGAAATTTTGCGG - Intergenic
926358025 2:12059063-12059085 TTGAAGTTGAATATATGTCCAGG + Intergenic
927327218 2:21818967-21818989 TAGGAGTTAAATAAATTTGGAGG - Intergenic
929446657 2:42007459-42007481 AAGAAGTGGGAGAAATTTTCAGG + Intergenic
930087318 2:47506945-47506967 TAGAGGTGGAATCAAGTTTCTGG - Intronic
930248230 2:49006548-49006570 TAAAAGAAGAATAAATTTCCTGG - Intronic
930291771 2:49502997-49503019 TAGAAGTACAATAGATTTACTGG - Intergenic
930376541 2:50574243-50574265 TAGAAGTAGAATAAATTGGTGGG + Intronic
930404395 2:50936873-50936895 TAAAAAATGAATAAATTGTCAGG + Intronic
930570897 2:53085603-53085625 TATAAGATGAATAAATTATGGGG + Intergenic
930785715 2:55269613-55269635 TAGAAGTTGGAAAAATTAACTGG + Intergenic
930999881 2:57766629-57766651 TAAAGGATGAATAAATTTACAGG - Intergenic
931504524 2:62909917-62909939 TAAAAGTTAAAAAAATTTGCTGG - Intronic
931739888 2:65232503-65232525 TATAAGTAGAATAAATATTTTGG + Intronic
932030061 2:68174237-68174259 TAGAAGTTTAAAATATTTTTTGG + Intronic
932549710 2:72755555-72755577 TAGAACTTGAATTAACTTTTTGG - Intronic
933190833 2:79331512-79331534 GAAAAGTTGAAGGAATTTTCTGG - Intronic
933326188 2:80840828-80840850 GAGAAGTTCAGTAAAGTTTCAGG - Intergenic
933516110 2:83304432-83304454 TATAAGGTGAATAAATTCCCAGG - Intergenic
933554604 2:83816329-83816351 TAGAAGATGTATATATTTTGGGG + Intergenic
935465658 2:103395119-103395141 TAGAAGGTGAAGTAATTTACAGG - Intergenic
935892768 2:107697482-107697504 CAGAGGTTAAATAAACTTTCAGG + Intergenic
936846054 2:116834883-116834905 TAAAACTTGAATTATTTTTCTGG - Intergenic
937791464 2:125967080-125967102 TGGAAGGTGAATAAAAATTCAGG - Intergenic
938309834 2:130282229-130282251 GGGAAGTTGAATAATTTTTGAGG - Intergenic
938320714 2:130360663-130360685 TGCAAGTTGAATAAATTATATGG + Intronic
939070339 2:137532126-137532148 TAGGAGTTCAATAAATGTTTGGG + Intronic
939436577 2:142184705-142184727 TAGAAGTAGAAGCAATGTTCTGG + Intergenic
939873980 2:147555641-147555663 TAGATGTTGAAGTAATTTACGGG - Intergenic
940078072 2:149766160-149766182 TAAAACTTAAATAAATTATCTGG - Intergenic
941093086 2:161201265-161201287 TAGCTATTGAATACATTTTCAGG + Intronic
941139357 2:161759421-161759443 TATAAGATGAATAAGTTTTGGGG - Intronic
941413511 2:165189716-165189738 TAAAGGATAAATAAATTTTCAGG - Intronic
941517811 2:166501518-166501540 TATAAGATGAATAAATTTTAGGG + Intergenic
941732230 2:168931554-168931576 TTGAGATTGAATTAATTTTCAGG + Intronic
942277199 2:174332083-174332105 TAAAAGTTAAAGCAATTTTCAGG - Intergenic
942950017 2:181711858-181711880 TAAAAGTTCAAAAAATTTGCAGG + Intergenic
943413312 2:187566188-187566210 TAGAAATAAAATAAAATTTCAGG + Intergenic
944611626 2:201414677-201414699 TAGAATTTGGATATATGTTCAGG - Intronic
945527734 2:210909699-210909721 TTGAAGATATATAAATTTTCAGG - Intergenic
945541028 2:211086974-211086996 CAGAAGTTGGTAAAATTTTCTGG + Intergenic
946544914 2:220729423-220729445 TAGAAGTTGAAAAGATATTGAGG + Intergenic
947444837 2:230155913-230155935 TAGAAGGAAATTAAATTTTCAGG + Intergenic
947845461 2:233240089-233240111 TCGGATTTGAATAAGTTTTCTGG + Intronic
949077023 2:242066654-242066676 AAGAAGTAGAATAAATTGACGGG - Intergenic
1169616591 20:7454506-7454528 TCGTAGTTGAAGAAATGTTCAGG - Intergenic
1169828443 20:9795586-9795608 TAGATGTTGAATAAAATTTGTGG + Intronic
1171506977 20:25644861-25644883 TAGAAGTTCTTTAAATATTCTGG + Intergenic
1174314049 20:49683307-49683329 TTTAAGCTGAATAAATTGTCAGG + Intronic
1174987841 20:55475320-55475342 TAGATGTTACTTAAATTTTCTGG - Intergenic
1177358176 21:20035924-20035946 TAGAATTAGAATAACTCTTCTGG - Intergenic
1177544022 21:22533331-22533353 TACAATTTGAATTAATTTCCAGG - Intergenic
1180364684 22:11927839-11927861 AAGAAGTTGAATATCTTTTCTGG - Intergenic
1181664797 22:24386556-24386578 TAGCAAGTGAAAAAATTTTCAGG + Intronic
1183043680 22:35202762-35202784 TAGAAGAAGAATAAAGTTTGTGG + Intergenic
1184011546 22:41752420-41752442 GAGAAGTTAAAAAACTTTTCCGG + Intronic
1185363838 22:50425899-50425921 TAGAAGTTCTATATATATTCTGG + Intronic
949736386 3:7176817-7176839 TAGAAGATGGATGAGTTTTCTGG - Intronic
949908123 3:8876052-8876074 TAGCAGCTGGATACATTTTCTGG - Intronic
951001412 3:17564254-17564276 TAAAAGTTGAAAAACTTTACAGG + Intronic
951049014 3:18073488-18073510 TAGATCTTGGAGAAATTTTCTGG + Intronic
951798360 3:26567107-26567129 TATAAGTTTAGCAAATTTTCAGG + Intergenic
952490500 3:33867327-33867349 CAGAATTTGCATCAATTTTCTGG - Exonic
953038822 3:39237002-39237024 TAGGACTTGAATATATTTTTGGG - Intergenic
953485603 3:43291666-43291688 TAGAAGTTGAGTAACTTGTTGGG + Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
957255435 3:77830218-77830240 TGTAAGTTGAATAAAAATTCAGG - Intergenic
957403788 3:79750556-79750578 TAGGAGGTGAATAAATTATGAGG + Intronic
957556759 3:81772039-81772061 TAGAACTTGGATATATTTTGAGG - Intergenic
957688371 3:83534587-83534609 TAAAAGTTGGTAAAATTTTCTGG + Intergenic
957720444 3:83990030-83990052 TAGAAGCTAAATAAATGTTCAGG + Intergenic
957741580 3:84277462-84277484 GAGAAACAGAATAAATTTTCTGG - Intergenic
957951701 3:87135797-87135819 TAGAAGAAGAGAAAATTTTCTGG + Intergenic
958142488 3:89579879-89579901 GGGAAGTGGAATAAAATTTCAGG + Intergenic
958716821 3:97793889-97793911 AAGTAGTAGAATAAATTTGCTGG - Intronic
959114160 3:102156269-102156291 TAGTAGTTGTATATATTTACAGG - Intronic
959182376 3:102997986-102998008 TAGTAGTTGTATATATTTACAGG - Intergenic
959267428 3:104160518-104160540 TAAAAGTCGTATAAATTTTAAGG + Intergenic
959457388 3:106579682-106579704 TCTAATTTGAATAACTTTTCTGG + Intergenic
959575631 3:107929925-107929947 CAGATGTTTAATACATTTTCTGG + Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
960369939 3:116822729-116822751 AAGAAGCTGAATACATTTGCAGG - Intronic
960851733 3:122062026-122062048 AAGAAGTTGAAAAAATGTACAGG - Intronic
960896153 3:122507730-122507752 TAAAAGTTGAATGATTTTTTGGG + Intronic
961071446 3:123932554-123932576 TAGAAACTGAAAAAGTTTTCTGG + Intronic
962635490 3:137327115-137327137 CAGAAGTTGCAAGAATTTTCTGG + Intergenic
963656786 3:148062720-148062742 TAGAAGCTGAATAACTCTTTTGG - Intergenic
964287229 3:155131617-155131639 AAGAAGTTGTACAAATCTTCAGG + Intronic
964410827 3:156396001-156396023 TAGAAGTCGAAACAATTTACTGG + Intronic
964745547 3:160008805-160008827 TAAAAGTACAAAAAATTTTCTGG + Intergenic
964888468 3:161511699-161511721 TAAAAGTGAAATAAATTTTGGGG + Intergenic
965029190 3:163341522-163341544 TAGAAGTTCACAAGATTTTCTGG + Intergenic
965226068 3:165992790-165992812 TGGAAGTTGAAGAAATTTGTAGG + Intergenic
965742336 3:171889149-171889171 TAGAAGTTCCTTAAATATTCTGG + Intronic
965930037 3:174031001-174031023 TAGAAGGTGAAGAAATTTAAGGG + Intronic
966922364 3:184621129-184621151 TATAAGATGAATAAATTATGGGG + Intronic
967621942 3:191643842-191643864 AAGAGGTTGAGAAAATTTTCAGG - Intergenic
968941083 4:3638316-3638338 TAGAAGGTGCATAAACTTTGAGG - Intergenic
969074984 4:4570756-4570778 TAGAGGTTGGATACCTTTTCTGG - Intergenic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
970540336 4:17071602-17071624 TAAAAGTAAAATAAATTTTGTGG - Intergenic
970557622 4:17250680-17250702 TTTAAGTTGTATAATTTTTCTGG - Intergenic
971474098 4:27056363-27056385 TAGCAGCTGAACAAATTCTCAGG - Intergenic
971590845 4:28467418-28467440 TATAATTTGAATAAATTCTGGGG + Intergenic
971743549 4:30551094-30551116 TAAAAGTTCAGAAAATTTTCAGG + Intergenic
972129422 4:35811942-35811964 TAGAAGTTGAATACATTGTGTGG - Intergenic
973060996 4:45724354-45724376 GAGAAGTTAAATAAAGTTCCAGG + Intergenic
973656530 4:53053819-53053841 TAGTAGATGTATATATTTTCAGG + Intronic
974257312 4:59476112-59476134 TAAAAGTTGAATAAACTATTTGG + Intergenic
974676328 4:65094422-65094444 TAGAATTTCAATAGATTTTCAGG + Intergenic
974760753 4:66270495-66270517 TATCAGTTCAAGAAATTTTCGGG - Intergenic
974793484 4:66719190-66719212 AAGAAGTTAAACAAATTTACAGG + Intergenic
975108151 4:70592625-70592647 TAGAAGATGAGTAAATTTCTAGG + Intronic
975837665 4:78441615-78441637 TAGAAGGTGAATAAATATTATGG + Intronic
976504759 4:85833687-85833709 TAAAAGTTTAAAAACTTTTCTGG - Intronic
976764054 4:88580536-88580558 AGGAAGTGGAATTAATTTTCTGG + Intronic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
976879038 4:89895672-89895694 TTGAATTTGAAATAATTTTCTGG - Intronic
976892532 4:90067633-90067655 TAGAAGTTAAAAAAAGTTTGTGG - Intergenic
976916385 4:90380322-90380344 TATAAATTAAATAAATCTTCAGG + Intronic
978115305 4:105012991-105013013 TATACGTTGAAAATATTTTCTGG - Intergenic
978286781 4:107087660-107087682 TAGGAATTGTATAATTTTTCAGG - Intronic
979173028 4:117625816-117625838 TAAAAGTTCAACAAATTTGCAGG + Intergenic
979308942 4:119179386-119179408 TACTATTTAAATAAATTTTCAGG - Intronic
979400206 4:120239918-120239940 TATAGGTTGAACATATTTTCAGG + Intergenic
980034801 4:127871545-127871567 TAGGACTTGAATAAGTTTTGGGG + Intergenic
981955812 4:150472463-150472485 TACAAATTGAATAAATTTTATGG - Intronic
982113368 4:152076209-152076231 TAAAAGTTGTATATAATTTCAGG + Intergenic
984359185 4:178706726-178706748 GAGAATTTGAACAATTTTTCAGG + Intergenic
984752724 4:183294379-183294401 TAGCAGTTTAATAAATTTGTAGG - Intronic
985020480 4:185683841-185683863 TAGAAGTTGATTAAATACTCAGG - Intronic
985059872 4:186066909-186066931 TAGAATGTGAATAAATTTAAGGG + Intergenic
1202763347 4_GL000008v2_random:131263-131285 AAGAAGTTGAATATCTTTTCTGG + Intergenic
986086207 5:4452744-4452766 TTGAAGTTGTTTAAATTTTGGGG - Intergenic
986143636 5:5055661-5055683 TGAAAGCTGAGTAAATTTTCTGG + Intergenic
986210716 5:5668667-5668689 TAGATGTTGAAACAATTTTTTGG + Intergenic
987024755 5:13914346-13914368 AAAAAGGTGAATAAATTTCCTGG + Intronic
987213870 5:15712917-15712939 TATAAGTTGTCTAAATTATCTGG + Intronic
987238660 5:15969794-15969816 TAGAAGTTGATTAAAAACTCAGG - Intergenic
987449449 5:18063663-18063685 TAGAATTTGAATCTATTTTGGGG + Intergenic
987647666 5:20696326-20696348 TAGAGGTTCAATAAATTGCCTGG + Intergenic
987835126 5:23150745-23150767 GAGAAGTTTAGTAATTTTTCTGG - Intergenic
988282564 5:29168922-29168944 TGGAATTTTAGTAAATTTTCTGG + Intergenic
988382173 5:30511854-30511876 TAGAAGTTTGAAAAACTTTCTGG - Intergenic
988535425 5:32063632-32063654 TAGAAGCTCAATAAATGTTTAGG - Intronic
988748672 5:34172533-34172555 TAGAGGTTCAATAAATTGCCTGG - Intergenic
988888126 5:35581726-35581748 TAGAAGTTTAGAAAATTTGCAGG - Intergenic
989803766 5:45579182-45579204 GAGAATTTGACTAAATTTTTAGG - Intronic
990469127 5:56097540-56097562 TGAAATTTGAATGAATTTTCTGG + Intergenic
991008743 5:61859348-61859370 TATAAGATGAATAAATTTTGGGG + Intergenic
992305008 5:75428060-75428082 TAGAAATGTAATAGATTTTCAGG - Intronic
992694989 5:79277268-79277290 TAGAAATTGAAGAAATTTATTGG + Intronic
993035676 5:82754765-82754787 TAGAAGGAGAATAAATGTTATGG + Intergenic
994335578 5:98561742-98561764 TAGAAGGTGATTAAATCTTGAGG + Intergenic
994864444 5:105247841-105247863 AATAACTTGAATATATTTTCAGG + Intergenic
995045820 5:107645275-107645297 TAGAAGTTGAAGTAATTTCCGGG + Intronic
995100916 5:108304353-108304375 TAAATGTTGAATAAACCTTCTGG - Intronic
995367587 5:111381043-111381065 GAGAAGGTGAATAAAGTTTCTGG - Intronic
997083768 5:130771961-130771983 TAGTAGTTGTATATATTTTTGGG - Intergenic
997832517 5:137163165-137163187 TTGTTGTTGAATAAATTTACTGG - Intronic
998696055 5:144641073-144641095 AACAATTTGAATAAATTTCCAGG - Intergenic
999529057 5:152441781-152441803 TAGTAGTTGTATAAATTTGGTGG - Intergenic
999570394 5:152913635-152913657 TACAAGGAGAATAATTTTTCAGG + Intergenic
1000469530 5:161623225-161623247 TAGAAGTTCTATATATTTTATGG - Intronic
1000745967 5:165034314-165034336 TAGAAATATAATAAACTTTCTGG + Intergenic
1003728225 6:8790749-8790771 TAAAAGTTTAAAAAATTTTAAGG + Intergenic
1003884098 6:10505372-10505394 TAGAACATGAATAAATATTAGGG + Intronic
1004241639 6:13928078-13928100 TAGAAGCTGAAAAACTTTTGTGG + Intronic
1004952549 6:20690237-20690259 TATAAGTTGTATATATTTTTTGG + Intronic
1005224054 6:23620642-23620664 TAGAACTTGAACAAATCTTTTGG - Intergenic
1005546242 6:26875629-26875651 TAGAGGTTCAATAAATTGCCTGG - Intergenic
1006014015 6:31066531-31066553 TAGAAGCTGAAAAAGTCTTCTGG - Intergenic
1008015593 6:46515736-46515758 TAAAAGATGAGTAAATTTTGGGG - Intergenic
1008369761 6:50718880-50718902 TAAAAGTTGTATAAATCTTAAGG - Intronic
1008831289 6:55766033-55766055 AAGAAGCTTATTAAATTTTCTGG - Intronic
1010251900 6:73715649-73715671 TAGAAGATGTATATATTTACAGG + Intronic
1010279213 6:74004561-74004583 TAAAAGGTGAGTGAATTTTCTGG - Intergenic
1010446227 6:75951538-75951560 TGGAAAGTGAATAAAATTTCTGG - Intronic
1011075900 6:83438193-83438215 TCCAAATTGAAAAAATTTTCAGG - Intergenic
1011202807 6:84855870-84855892 TATAAGTTGAATAAATTCTGAGG + Intergenic
1011258825 6:85450905-85450927 AAGAAGCTGAATAAATTAACAGG + Intronic
1011406472 6:87020570-87020592 AAGAAGTTGCATATATTTCCTGG + Intergenic
1011458605 6:87579438-87579460 TAGAAGTTATAAAAATTATCAGG - Intronic
1012715730 6:102666943-102666965 TAGTAGTTGTATAAATTTGTGGG - Intergenic
1013197105 6:107854155-107854177 TAGGAGTTCACTAAATATTCTGG + Intergenic
1014016209 6:116533262-116533284 CAGAAGTTGAAGAAATTTGTAGG + Intronic
1014540002 6:122663815-122663837 TAGGAGTTTAATATATTTTCGGG + Intronic
1015332418 6:131996224-131996246 TAGAGGTTCAATAAATGTTTTGG - Intergenic
1016443092 6:144104909-144104931 TAAAATTTGAATATAATTTCTGG - Intergenic
1016704067 6:147086531-147086553 TAGGAGTTTAATAAATATTCTGG - Intergenic
1016747347 6:147594947-147594969 TACTAGTTGAATAAAAATTCTGG - Intronic
1017264417 6:152425821-152425843 TAAAACCTGAATAAGTTTTCTGG + Intronic
1018043047 6:159941760-159941782 TAGAAGTTGACTTGACTTTCAGG - Intergenic
1020549393 7:9582867-9582889 TAGAAGTTGTATTTGTTTTCAGG + Intergenic
1021455173 7:20822134-20822156 AAGAACTTAAACAAATTTTCAGG - Intergenic
1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG + Intronic
1022605123 7:31805517-31805539 GAGAAGTTGAATAAAAATCCAGG - Intronic
1022890640 7:34694291-34694313 AACAACTTCAATAAATTTTCAGG + Intronic
1023139765 7:37090342-37090364 TAGAATTAGATTATATTTTCTGG - Intronic
1024629143 7:51232861-51232883 AAGAAATTGAATAAATGTTCAGG - Intronic
1024898117 7:54283594-54283616 TAGAAGTTTAAAAAAATCTCAGG - Intergenic
1025226844 7:57172912-57172934 GGGAAGTTGAATAATTTTTGAGG - Intergenic
1025229905 7:57196193-57196215 GGGAAGTTGAATAATTTTTGAGG - Intergenic
1026669764 7:72379473-72379495 TAGAGGTTGAGTGACTTTTCTGG - Intronic
1027641521 7:80739248-80739270 TAGAAATAGTATAAAATTTCTGG + Intergenic
1028160441 7:87478479-87478501 TAAAAGTGAAATAAATTTTCAGG - Intronic
1028270395 7:88781237-88781259 TAGAAGTTAATTAAATGATCAGG + Intronic
1029002667 7:97171246-97171268 TAATAATTGAATAAATTTTGGGG + Intronic
1029168167 7:98610895-98610917 TAGAATTTGAATAAAATTGGGGG + Intergenic
1029791899 7:102852316-102852338 TACAAATTGAATAAATTTTGTGG - Intronic
1030635369 7:111942188-111942210 TAGAGGTTGAAGAAACTTCCTGG + Intronic
1030788053 7:113686581-113686603 TAGAAGCAGAATTAATTTTTAGG + Intergenic
1030926147 7:115457268-115457290 TATATGTTGAATAAATATTGAGG - Intergenic
1031172714 7:118311971-118311993 GCAAATTTGAATAAATTTTCAGG + Intergenic
1031369644 7:120949159-120949181 TAGAATTTTCATAATTTTTCAGG - Intergenic
1031733704 7:125330157-125330179 TGTAAGTTGAATTATTTTTCAGG - Intergenic
1032435921 7:131900254-131900276 TAGATCTAGAATACATTTTCTGG - Intergenic
1032978396 7:137252285-137252307 AAGATGCTGAATATATTTTCAGG + Intronic
1033831217 7:145255691-145255713 GAGATGTTGAATATTTTTTCAGG + Intergenic
1033882111 7:145898000-145898022 TAAAAATTCAGTAAATTTTCAGG - Intergenic
1033884977 7:145933718-145933740 TAGAAGTTCAGAAAATTTGCAGG + Intergenic
1034523665 7:151640419-151640441 GAGAAGGTGAATAAATGATCAGG - Intronic
1034687752 7:152988293-152988315 TATAAGATGAATAAATTCTGGGG + Intergenic
1035864786 8:3070337-3070359 TAAAAGTTTAAAAAATTTGCAGG - Intronic
1036237308 8:7051297-7051319 TAAAAGTAGAAAAAATTATCTGG + Intergenic
1036609526 8:10337594-10337616 TGGAAGTTGGTTAATTTTTCTGG + Intronic
1036815154 8:11896840-11896862 TGGAAGTTGGTTAATTTTTCTGG + Intergenic
1037794224 8:21978329-21978351 TAGAACGTGAATGAATTTTGAGG - Intronic
1038238071 8:25781289-25781311 AAGAAGATGAAGAAATTTTGGGG + Intergenic
1038718058 8:30009461-30009483 TAGAAGTTGCATTAATTTCTTGG - Intergenic
1038994467 8:32906332-32906354 TAGAAGTTAAATAAGTTTCCAGG + Intergenic
1039680848 8:39734472-39734494 TAGAAGTTGTATATCTATTCTGG - Intergenic
1040088235 8:43367332-43367354 AAGAAGTTGAATATCTCTTCTGG - Intergenic
1040370883 8:46772411-46772433 ATGATGTTGAATAACTTTTCAGG + Intergenic
1041153992 8:54964639-54964661 TAGTAGTTGTACAAATTTTGGGG + Intergenic
1041352262 8:56959256-56959278 TGGATGTTGAATTAATTTTGTGG - Exonic
1042478193 8:69273791-69273813 TATATGTTGAATGAATTTTAGGG - Intergenic
1042621190 8:70706323-70706345 TTGAAGTTTTATATATTTTCTGG + Intronic
1043767309 8:84152219-84152241 AAGAAGTTGAAAATAATTTCTGG - Intergenic
1044168147 8:89014950-89014972 TAGGAGTTGGATAAGTTTCCAGG - Intergenic
1044276995 8:90312830-90312852 TAGAAGCTGAATATCTTTTGGGG - Intergenic
1045182486 8:99799887-99799909 TCGGATTTGAATAAATATTCTGG - Intronic
1045767101 8:105686074-105686096 TAGAAATTCAATAAAGTTTAAGG - Intronic
1045987248 8:108262905-108262927 AATAAGTTGAATAAATGATCTGG - Intronic
1045991459 8:108313776-108313798 TAGAAGATGTATAACTTTTAAGG + Intronic
1046522345 8:115341720-115341742 TTAAAGTTGAATAACTTTCCTGG + Intergenic
1046617443 8:116492930-116492952 TGAAGGATGAATAAATTTTCTGG - Intergenic
1046658757 8:116925730-116925752 TAGACGTTGCATAACTTTCCTGG - Intergenic
1046671122 8:117057361-117057383 TATAAGATGAATAAATTCTTGGG + Intronic
1046671128 8:117057470-117057492 TATAAGATGAATAAATTCTTGGG - Intronic
1046752806 8:117942841-117942863 TACAAGTTGAATAAATTGGATGG + Intronic
1046997061 8:120535153-120535175 ATGAAGTTGAATATAGTTTCAGG - Intronic
1047872104 8:129095526-129095548 GAGAAGTAGAATAAATATACTGG - Intergenic
1048561664 8:135545082-135545104 GAGAATTTGAATATATTATCTGG + Intronic
1048869696 8:138786972-138786994 TAGAAGTTAAATGACTTTCCTGG - Intronic
1050110945 9:2215230-2215252 TAGAAGTTAAATAACTTTTGTGG - Intergenic
1050130277 9:2405264-2405286 TATAAGTATAATATATTTTCTGG + Intergenic
1050251197 9:3746745-3746767 TAGAAGTTGAGATAATTTACTGG - Intergenic
1050663396 9:7908499-7908521 AATAATTTGAATAAATGTTCAGG + Intergenic
1051113760 9:13670788-13670810 AAGAAGTAGAGTAATTTTTCAGG + Intergenic
1052685915 9:31755927-31755949 TAGATTTTTAATAAATTTCCCGG - Intergenic
1057595038 9:96408656-96408678 TACAAGATGAATAAATTCTAGGG + Intronic
1057971171 9:99559213-99559235 TAGAAGTTGGTTGAAGTTTCTGG - Intergenic
1058210028 9:102155720-102155742 AAGAAATTCAGTAAATTTTCAGG - Intergenic
1058291688 9:103249919-103249941 TATTAGTTGAATAACTTTCCTGG + Intergenic
1058912978 9:109537959-109537981 TAGAATATGAATAAAGTTTGTGG - Intergenic
1058985438 9:110205630-110205652 AACAAGTTACATAAATTTTCTGG - Intronic
1059375694 9:113879345-113879367 TAGAAGTTGAAAATCATTTCTGG + Intronic
1060093041 9:120761657-120761679 AAGTAGTTGAATAAAATCTCAGG + Exonic
1060792120 9:126492871-126492893 TTCAAGTTGAACAACTTTTCAGG + Intronic
1203544108 Un_KI270743v1:116136-116158 AAGAAGTTGAATATCTTTTCTGG + Intergenic
1185951115 X:4435388-4435410 TAGAAGATGAATAACTTTGTGGG - Intergenic
1185963365 X:4571437-4571459 TAGAAGATGTATATATTTTGGGG + Intergenic
1186013714 X:5167026-5167048 TAGAAGTTTAACAGCTTTTCCGG - Intergenic
1186610952 X:11138208-11138230 TAGATATTGAATACGTTTTCAGG - Exonic
1187118676 X:16381559-16381581 TAGGAGTTTAATAATATTTCAGG - Intergenic
1187179499 X:16930221-16930243 TAAAAATTGAATAAAATTTGTGG + Intergenic
1189003074 X:36965385-36965407 TAGAAGTTTTATTTATTTTCAGG - Intergenic
1189062271 X:37767362-37767384 TAAAAGTTGAAGAAGTTTGCTGG - Intronic
1190040792 X:47070254-47070276 TAGAAATTTAAGAATTTTTCAGG - Intergenic
1191853185 X:65601439-65601461 AAGAAGTAGAATAACTTTTCCGG + Intronic
1191934750 X:66414765-66414787 TAGAAGTTAAGTAACTTGTCTGG - Intergenic
1192056888 X:67782156-67782178 TAGAATTTGAAAAAATTTATGGG - Intergenic
1192583441 X:72302883-72302905 CAGAAGTTGGATAAATTGGCGGG + Exonic
1192617948 X:72647416-72647438 GACATGTTGAATAAATTTACAGG + Intronic
1193151888 X:78134055-78134077 CAGAAAGGGAATAAATTTTCTGG - Intronic
1193356627 X:80526643-80526665 TATAAGTTCAAGAAATTTTGGGG - Intergenic
1193805660 X:85991013-85991035 TAGGAGTTGAAAATGTTTTCAGG + Intronic
1194009484 X:88541845-88541867 TAAAACTAGTATAAATTTTCTGG - Intergenic
1194094604 X:89622190-89622212 TAAAAGTAGAATAAAGTGTCAGG - Intergenic
1194302677 X:92207135-92207157 TAGAAATTGAAAATGTTTTCAGG - Intronic
1194326832 X:92529108-92529130 TATAGGATGAAAAAATTTTCTGG + Intronic
1194334504 X:92628967-92628989 TAGAAGGTGATTAAGTTTTGAGG - Intergenic
1195448867 X:104986800-104986822 TGTAAGTTGAATAAATTGCCTGG + Intronic
1195822419 X:108960492-108960514 TAGAAGTTCTTTAAATATTCTGG - Intergenic
1195856794 X:109340418-109340440 TAGTAGTTGTATATATTTACAGG - Intergenic
1196080427 X:111624563-111624585 AAGAAGATGAAGAAGTTTTCAGG - Intergenic
1196440645 X:115716847-115716869 TAGAAGGTGAATAATTCTACAGG - Intergenic
1196538017 X:116870574-116870596 TAGAAGGTGATTAAATTATGAGG + Intergenic
1196573992 X:117297236-117297258 TAGTAGTTGTATATATTTACGGG + Intergenic
1197038870 X:121910063-121910085 TAAAAATAGAATAAATCTTCAGG - Intergenic
1197411593 X:126123015-126123037 TATATTTTGAATTAATTTTCTGG + Intergenic
1198161188 X:134010367-134010389 TAGGTGTTCAATAAACTTTCTGG + Intergenic
1198452391 X:136779854-136779876 TAGAATTTTATTAAATTATCAGG - Intronic
1198891974 X:141406996-141407018 TAGAATTTGATTCAGTTTTCAGG - Intergenic
1200447237 Y:3278358-3278380 TAAAAGTAGAATAAAGTGTCAGG - Intergenic
1200635549 Y:5648317-5648339 TATAGGATGAAAAAATTTTCTGG + Intronic
1201906772 Y:19093473-19093495 TAGAAGTTGAACATATTTTGGGG + Intergenic
1202580941 Y:26379875-26379897 TTGATGTTGAATATCTTTTCAGG + Intergenic
1202586221 Y:26430679-26430701 TAGAAGTTGATTAGAAGTTCTGG + Intergenic