ID: 1022604204

View in Genome Browser
Species Human (GRCh38)
Location 7:31792323-31792345
Sequence TTGAGCATATGCTATGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3256
Summary {0: 2, 1: 8, 2: 84, 3: 629, 4: 2533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022604204_1022604208 28 Left 1022604204 7:31792323-31792345 CCTGACACATAGCATATGCTCAA 0: 2
1: 8
2: 84
3: 629
4: 2533
Right 1022604208 7:31792374-31792396 TGAATAAGCATGAGGAGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 251
1022604204_1022604207 27 Left 1022604204 7:31792323-31792345 CCTGACACATAGCATATGCTCAA 0: 2
1: 8
2: 84
3: 629
4: 2533
Right 1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG 0: 1
1: 0
2: 2
3: 28
4: 314
1022604204_1022604206 23 Left 1022604204 7:31792323-31792345 CCTGACACATAGCATATGCTCAA 0: 2
1: 8
2: 84
3: 629
4: 2533
Right 1022604206 7:31792369-31792391 AGAATTGAATAAGCATGAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 247
1022604204_1022604205 20 Left 1022604204 7:31792323-31792345 CCTGACACATAGCATATGCTCAA 0: 2
1: 8
2: 84
3: 629
4: 2533
Right 1022604205 7:31792366-31792388 AAGAGAATTGAATAAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022604204 Original CRISPR TTGAGCATATGCTATGTGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr