ID: 1022604207

View in Genome Browser
Species Human (GRCh38)
Location 7:31792373-31792395
Sequence TTGAATAAGCATGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022604204_1022604207 27 Left 1022604204 7:31792323-31792345 CCTGACACATAGCATATGCTCAA 0: 2
1: 8
2: 84
3: 629
4: 2533
Right 1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG 0: 1
1: 0
2: 2
3: 28
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022604207 Original CRISPR TTGAATAAGCATGAGGAGGA TGG Intronic
902512758 1:16975181-16975203 TTGAATAAACATCAGGTGGGTGG + Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
912731456 1:112110216-112110238 ATGATTAAGCTTGGGGAGGAAGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
919869264 1:201808289-201808311 TTCAATCAGCATGAGAAGAAAGG - Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
921521064 1:216154652-216154674 TTGCCTAGGCCTGAGGAGGAGGG - Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1064149482 10:12850537-12850559 TTGAATAAGCCAGATGAGGAAGG - Intergenic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075330091 10:121567611-121567633 TTGCTTAAGCATTAGGAAGAAGG + Intronic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1076768301 10:132649681-132649703 TTGAATAAGCATGCGTGGGTAGG + Intronic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG + Intronic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1085448402 11:76616200-76616222 TTGAACAAGCATGTGGCAGAGGG - Intergenic
1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG + Intergenic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1088458812 11:110061080-110061102 TTGAGTAAGCAAGAGGGGAATGG + Intergenic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092589783 12:9941836-9941858 GAGAATGAGCATGAGGAGAATGG + Intergenic
1093018848 12:14184513-14184535 TTAAATAAGCGTGGGGAGCATGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093285079 12:17249220-17249242 TTTACTAAGAATGAGGTGGAAGG + Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG + Intronic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1103590771 12:121990493-121990515 GGAAACAAGCATGAGGAGGAGGG - Intronic
1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG + Intronic
1108887975 13:55212993-55213015 TTGAGTAAGGATGTGAAGGATGG + Intergenic
1109207015 13:59493691-59493713 TTGAATAACCACAAGGATGAAGG - Intergenic
1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1111039734 13:82731046-82731068 TTGAATAAACCTGAGGACAATGG - Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG + Intergenic
1113225428 13:108154118-108154140 TTAAATGAGCTTCAGGAGGAAGG - Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115862216 14:37700151-37700173 TTGTATAAGCTTTAGTAGGAAGG + Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117272856 14:54162944-54162966 TAGAATAAACATGAGGACTAAGG + Intergenic
1118964889 14:70571589-70571611 TTGTATAGGCATGGGGAGAATGG - Intergenic
1119628912 14:76208919-76208941 TTAAATCAGCATGGGGAGGTGGG + Exonic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG + Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1134564251 16:15237293-15237315 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1134738243 16:16519406-16519428 TTTATTAAGCTTGAGGAGGTGGG + Intergenic
1134929256 16:18192757-18192779 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1140050888 16:71480086-71480108 TTGAAAAAGCATGAGGGGCTGGG - Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG + Intergenic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1153320377 18:3767875-3767897 TTGAATAAGCATGATAAGAGTGG - Intronic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1159913662 18:74169646-74169668 CTGAATCACCATGAGGAGCAGGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161933701 19:7357848-7357870 ATGAAAAAGCATGAGCAGAATGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
926180706 2:10640662-10640684 TTTAATTAGCATGAGTATGAGGG - Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG + Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG + Intronic
940491230 2:154363752-154363774 TTGCATAAACATGATGTGGAAGG - Intronic
941244266 2:163077819-163077841 ATGAATAAACATGAATAGGAGGG - Intergenic
941310074 2:163916807-163916829 TTGAATAAGCAAGAGTAACAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947255584 2:228160198-228160220 TTGTATAATCATGGGGAAGATGG - Intronic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
949562764 3:5218047-5218069 TTCCAGGAGCATGAGGAGGAAGG - Exonic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
956530817 3:70216664-70216686 TTCAATAAGCTTTAGGATGAAGG - Intergenic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957259689 3:77884926-77884948 TTGAATAATCATGAGATGGAAGG + Intergenic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967667209 3:192187643-192187665 TTGAATAAGAATCAGGACCAAGG + Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG + Intronic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
972814991 4:42634717-42634739 TTGCATATGCATGAGGAGCCAGG - Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976315993 4:83659724-83659746 CTTAATAAGCAAGAGCAGGAAGG + Intergenic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
980307899 4:131088286-131088308 TTAAATAAGAATGTGGGGGATGG - Intergenic
980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG + Intergenic
980773921 4:137414956-137414978 TTGATTAGGCAAGAGGATGACGG - Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982644352 4:158004860-158004882 TCGAAGAATCCTGAGGAGGATGG - Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG + Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
984624883 4:181996007-181996029 TTGAGTTTGCCTGAGGAGGAGGG - Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987430241 5:17824181-17824203 TTGAATAAGAGTGATGAGGGAGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990722944 5:58718526-58718548 TAGAATAAGCCTGAGGCAGAAGG - Intronic
991226661 5:64281338-64281360 TTGACTAGGCATGATGAGAATGG + Intronic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992035491 5:72770643-72770665 TTGAACAAGCACCAGTAGGAGGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994424827 5:99572076-99572098 TTGAATAGGCATGGTGAGGGTGG - Intergenic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998345011 5:141454694-141454716 TGGAATAAGCAGGTGGAGCATGG - Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG + Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1001404929 5:171469515-171469537 TTGACTCAGCCTGGGGAGGAAGG - Intergenic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1005244045 6:23861631-23861653 TTGAATAAGTGTGATGAGAATGG - Intergenic
1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG + Exonic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006252661 6:32801980-32802002 TTGAATAAGCATGGCGAGAGTGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007615123 6:43175203-43175225 TTCTATAAGCATGAGGGGGCTGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010324909 6:74553325-74553347 TTGAGAAAGCATGAGCAGGTGGG - Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022910850 7:34898611-34898633 GTGAATAGGCATGAGGAACAGGG - Intergenic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1028150658 7:87367672-87367694 TTGACTAAGCAAGAGGAAGCGGG - Intronic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1030763098 7:113375543-113375565 TTTAATAAGCATGAGATGGCAGG - Intergenic
1031137832 7:117904504-117904526 TTGAATAAGAAAGGGCAGGAAGG + Intergenic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032885377 7:136132725-136132747 TAGAATAATCATGATGATGAAGG - Intergenic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033801503 7:144907497-144907519 TGGATTATGCATGTGGAGGAAGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1041199149 8:55433715-55433737 TTAAATGAGTATTAGGAGGAAGG + Intronic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1041770037 8:61463447-61463469 ATGATTAAGCTTGGGGAGGAAGG - Intronic
1041969443 8:63720617-63720639 TTGAAGATGCATGAGGGAGAAGG + Intergenic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042352731 8:67794161-67794183 TTGAATGACCTTGAGGAGGTGGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042852905 8:73234462-73234484 TTGAAAAAGCCTGAGGAGTGGGG - Intergenic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG + Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG + Intergenic
1051197734 9:14581570-14581592 TTGAATAAGAGTGGGGAGGCTGG - Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055660601 9:78500116-78500138 TGGAATGACCATGTGGAGGAGGG + Intergenic
1055737753 9:79350545-79350567 TTAAACAAGCTTGGGGAGGAAGG - Intergenic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic