ID: 1022607348

View in Genome Browser
Species Human (GRCh38)
Location 7:31828573-31828595
Sequence ACATGAACTTTGCAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022607348_1022607353 11 Left 1022607348 7:31828573-31828595 CCACCCAACTGCAAAGTTCATGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1022607353 7:31828607-31828629 AAGCCTCATTGGGCAGTACTAGG 0: 1
1: 0
2: 3
3: 14
4: 120
1022607348_1022607355 21 Left 1022607348 7:31828573-31828595 CCACCCAACTGCAAAGTTCATGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1022607355 7:31828617-31828639 GGGCAGTACTAGGACCTCCATGG No data
1022607348_1022607356 30 Left 1022607348 7:31828573-31828595 CCACCCAACTGCAAAGTTCATGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1022607356 7:31828626-31828648 TAGGACCTCCATGGAAAATAAGG 0: 1
1: 0
2: 1
3: 10
4: 118
1022607348_1022607352 1 Left 1022607348 7:31828573-31828595 CCACCCAACTGCAAAGTTCATGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1022607352 7:31828597-31828619 GCTGTAAAGAAAGCCTCATTGGG No data
1022607348_1022607351 0 Left 1022607348 7:31828573-31828595 CCACCCAACTGCAAAGTTCATGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1022607351 7:31828596-31828618 TGCTGTAAAGAAAGCCTCATTGG 0: 1
1: 0
2: 0
3: 11
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022607348 Original CRISPR ACATGAACTTTGCAGTTGGG TGG (reversed) Intronic
900883209 1:5397115-5397137 AAATGGAATTTGCATTTGGGTGG + Intergenic
905169312 1:36099827-36099849 AGATGAACTGGGAAGTTGGGAGG - Intronic
907125330 1:52045357-52045379 ATATGAACTTTGGAGTGGGGTGG - Intronic
907302850 1:53499253-53499275 GCATGGGCTTTGCAGTTGAGAGG + Intergenic
907381661 1:54095705-54095727 ACATGAACTTTGGAGTCGAGGGG + Intronic
907729077 1:57048416-57048438 ACATGAAATTTGAAGTTAGTTGG - Intronic
910898095 1:92089787-92089809 ATATGAATTTTGGGGTTGGGGGG + Intronic
911156167 1:94638962-94638984 ATATGAACATTTCAGTTGAGTGG - Intergenic
913175217 1:116267078-116267100 ACATTCACTTTGCATTTGTGCGG + Intergenic
918269099 1:182878851-182878873 ACATGAACTAGGAAGGTGGGAGG + Intronic
919802523 1:201362154-201362176 ACATGTAGTTGGTAGTTGGGGGG - Intronic
919895863 1:202009540-202009562 ACATGAAAGTTGCAGTGTGGAGG - Exonic
920822439 1:209393599-209393621 AAAAGAACTTTGGAGTTGTGAGG - Intergenic
924863273 1:247949534-247949556 ACATGAAATCTGCAGAAGGGAGG + Exonic
924866744 1:247990944-247990966 ACATGCACTCTGCAGAAGGGAGG + Intronic
924872271 1:248061358-248061380 ACATGAAATCTGCAGAAGGGAGG + Exonic
1065794715 10:29295603-29295625 AAAGGAACTTTGCAGATGTGAGG + Intronic
1066500081 10:35984412-35984434 TCATGAACTTTGCAGTATAGTGG + Intergenic
1066627974 10:37428729-37428751 TCATGAACTTTGCAGTATAGTGG + Intergenic
1068347093 10:55795204-55795226 AAATTTAATTTGCAGTTGGGTGG + Intergenic
1068760883 10:60708020-60708042 TCATGTCCTTTGCAGTGGGGAGG - Intronic
1069194458 10:65531774-65531796 CTATGAACTTTGTAGTTGGATGG - Intergenic
1070348099 10:75565184-75565206 ACATGACCTTGGCAGGTCGGAGG + Intronic
1074021447 10:109588657-109588679 AAATAAACTTTGCAGTAGGTGGG - Intergenic
1074071972 10:110080317-110080339 ACATAAATATTGAAGTTGGGTGG - Intronic
1074718316 10:116241381-116241403 ACACGAACTGTGAAGTTGTGTGG - Intronic
1075509373 10:123057627-123057649 ATACTAACTTGGCAGTTGGGTGG - Exonic
1075673035 10:124277127-124277149 CCATGAACTTTCCAAGTGGGGGG + Intergenic
1077992367 11:7423401-7423423 ACATTCACTTTGGAGTTGGAAGG + Intronic
1078024359 11:7680568-7680590 GAATGAACTTTGAAGATGGGGGG + Intergenic
1082747816 11:56985082-56985104 AAATTAACTTTTCAGTTTGGAGG + Intergenic
1083151025 11:60791881-60791903 TCTTGAATCTTGCAGTTGGGAGG - Intronic
1084488479 11:69464618-69464640 ACCTGAACCTTGCCATTGGGTGG + Intergenic
1084925508 11:72508220-72508242 TCATGACCTTTGCAGCAGGGAGG - Intergenic
1085728212 11:78973950-78973972 GCAGGGACTTTGCAGTTGTGGGG - Intronic
1086453021 11:86935783-86935805 GCATGTACTTTGGAGTTGGCAGG - Intronic
1086853635 11:91840513-91840535 AAATCCACTTTGCAGTTGGCAGG + Intergenic
1087370256 11:97274496-97274518 ACATTAGCTTTGGTGTTGGGTGG - Intergenic
1087676517 11:101168901-101168923 ACATCTACTTTTCAGTTTGGAGG - Intergenic
1091581359 12:1792411-1792433 ACTTGAACTTTGAAGTGTGGAGG + Exonic
1095498635 12:42812261-42812283 CCATGACCTTGGCAGTTGAGTGG + Intergenic
1096230135 12:49892181-49892203 ACATGATATTTGCAGGTGGCAGG - Intronic
1097586971 12:61526795-61526817 ACAATAACTTTGGAGTTGGTAGG + Intergenic
1098390749 12:69967306-69967328 CCATGGACTTAGCAGTTAGGTGG + Intergenic
1098805438 12:75016073-75016095 TCATGCCCTTTGCAGTGGGGAGG - Intergenic
1099747006 12:86718350-86718372 TCATGAACTCAGCAGTTGAGTGG + Intronic
1100027920 12:90152138-90152160 GCATGAAGTCTGGAGTTGGGAGG + Intergenic
1101363733 12:104052251-104052273 ATATGAACTTTGAAGGTGGGAGG + Intronic
1101632376 12:106507693-106507715 ACATCAACTGTGCATTTGTGAGG + Intronic
1101767494 12:107715535-107715557 ACATGAACTTTGAAATAGGCAGG + Intergenic
1103326722 12:120126332-120126354 ACATGCCCTTGGCAGTTGGGAGG + Intergenic
1104787982 12:131462189-131462211 CCATGACCTTTGCTCTTGGGTGG + Intergenic
1106095297 13:26638022-26638044 ACCTGACCCTTGCAGTGGGGAGG + Intronic
1106138358 13:26991121-26991143 ATAAGAACTTTGGAGTTGGCCGG - Intergenic
1106272213 13:28165973-28165995 ACATGAATTTTGCAGGGGGTCGG + Intronic
1109019507 13:57069494-57069516 ACTTGAATATTGCAGTTAGGAGG + Intergenic
1109502695 13:63258008-63258030 ACATGAACATCTCAGTTAGGGGG + Intergenic
1109629890 13:65032816-65032838 ACATGCACTTTCCATTTGTGGGG - Intergenic
1111476566 13:88757187-88757209 ACATGAAGTTTGTAGAAGGGAGG - Intergenic
1112388548 13:98961962-98961984 ACATGAGCAATGCAGTTTGGGGG - Intronic
1114594759 14:23901997-23902019 ACATGAACATTGAAGTTAGTGGG - Intergenic
1115112317 14:29839447-29839469 CCATGAACTTTGCCTTTGGCAGG - Intronic
1116309535 14:43305909-43305931 TCATGCACTTTGCGGTGGGGAGG - Intergenic
1117289451 14:54318469-54318491 ACATCAACTGTGCACATGGGTGG - Intergenic
1118999208 14:70865979-70866001 GCATGAACTTTGGAGTTTGATGG + Intergenic
1119141988 14:72275727-72275749 ATATGAACATTAGAGTTGGGAGG - Intronic
1119715724 14:76857790-76857812 ACATCAGCTTTGCAGATGAGTGG + Intronic
1119766880 14:77195945-77195967 ACAAGCACGTTGGAGTTGGGAGG + Intronic
1120601725 14:86518991-86519013 GCATGAAATTTTCAGTTTGGTGG - Intergenic
1122110644 14:99498649-99498671 TCATGGACTCTGCAGTTGAGTGG + Intronic
1122765917 14:104069827-104069849 ACTTGAATTGTGCTGTTGGGGGG + Intergenic
1128931262 15:71706779-71706801 GCATGACCTTTGCAGGTGCGAGG + Intronic
1129687059 15:77692607-77692629 ACATGAGTTTTGCTGCTGGGAGG - Intronic
1130819396 15:87478401-87478423 ACATGGATTTTGGAGTAGGGTGG + Intergenic
1133442967 16:5836181-5836203 ACATGGGCTCTGCAGCTGGGGGG + Intergenic
1134205575 16:12235146-12235168 AGATGAACTTTGCAGTCAGTTGG + Intronic
1134386652 16:13779784-13779806 AAATGGACTTTCCACTTGGGCGG - Intergenic
1134606714 16:15577080-15577102 AAATGAACTTTCCACTTGGGCGG + Intronic
1135058022 16:19246911-19246933 AACTGAATTTTGCAGTTGAGAGG + Intronic
1136020137 16:27434874-27434896 CCATGGACTTTGGAGTTGGGCGG - Intronic
1137507511 16:49067121-49067143 ACATGAACTTTTCTGTGGCGAGG + Intergenic
1139130192 16:64133687-64133709 ACATGAATTTTGTAGTGGGAAGG + Intergenic
1140868894 16:79088810-79088832 CTATGGACTTTGCCGTTGGGTGG - Intronic
1144842258 17:18194501-18194523 ACATGAAGTCTCCATTTGGGGGG - Intronic
1146020464 17:29273818-29273840 ACATTAACTTTTCATTTGAGTGG - Intronic
1146810839 17:35901789-35901811 ATAGGAACTTTCCAGTTGGGAGG + Intergenic
1147504038 17:40996533-40996555 TCATGAAGTTTACAGTTTGGTGG + Intergenic
1149155220 17:53621406-53621428 ACATCCACTTTGCAGTTGATGGG - Intergenic
1149267699 17:54945340-54945362 ACATGAGCATAGCATTTGGGGGG + Intronic
1149652136 17:58282042-58282064 ACAGGATCAGTGCAGTTGGGAGG + Intergenic
1150476995 17:65483187-65483209 ACATGAACTTTGGTGGGGGGTGG + Intergenic
1153459993 18:5322666-5322688 ACATGAATTTTGTGGTGGGGGGG + Intergenic
1160001647 18:75030103-75030125 ACATGATCTTTGGGGCTGGGTGG + Intronic
1160760796 19:783151-783173 CCATGAACTTTGCAGGTTGGTGG + Intergenic
1161698794 19:5784137-5784159 ACAAGAACCTTGCCATTGGGGGG + Exonic
1162006449 19:7783438-7783460 ACATGCCCTTTGCAGTGGGCTGG + Intergenic
1164576414 19:29407901-29407923 ACCTAATCTTTGCAGTGGGGTGG + Intergenic
1164944098 19:32276809-32276831 ACATGCACTTTGCAATTGTTGGG - Intergenic
1165113789 19:33516895-33516917 ACTTTAACTTTGAAGTTGTGGGG - Intronic
926518076 2:13874760-13874782 ATATGGACTTAACAGTTGGGTGG - Intergenic
927705802 2:25295668-25295690 CCATAGGCTTTGCAGTTGGGAGG + Intronic
929255170 2:39802635-39802657 ACAACAACTTTGCAGCTTGGAGG - Intergenic
931628459 2:64277722-64277744 ACATGAACTTGGCATCTGGTTGG + Intergenic
932668006 2:73712389-73712411 ACATGAACTTTTCTGTTTTGAGG - Intergenic
933627746 2:84620847-84620869 ATTTGGACTTTTCAGTTGGGAGG + Intronic
936765699 2:115845971-115845993 ACATGAACTTCTAAGTTGGCTGG - Intergenic
937316460 2:120934825-120934847 TCATGAACTTTCCAGTCTGGGGG + Intronic
937612426 2:123878383-123878405 ACATGTACTTTCCAGTATGGAGG - Intergenic
937941578 2:127290354-127290376 AAATGAACTTTTCACTTGGTTGG - Intronic
939582921 2:143972483-143972505 AGATGAGGTTTGGAGTTGGGAGG + Intronic
944406665 2:199392487-199392509 ACATGACCTTTGCCTTTTGGTGG - Intronic
948627839 2:239280025-239280047 ACAGGCACTTTGGGGTTGGGGGG - Intronic
1172027698 20:31960318-31960340 ACATTAACTTTCCAGATGGGTGG - Intergenic
1185181588 22:49366511-49366533 AAATGAATTTTGCAGTGGGTGGG + Intergenic
950252953 3:11482152-11482174 TCATGAACTTTCCAGTTGGAAGG - Intronic
951811178 3:26701709-26701731 ACATGACCCCTGGAGTTGGGAGG - Intronic
953429498 3:42827181-42827203 ACATGTATTTTGCAGTTGTTGGG + Intronic
955298824 3:57757485-57757507 ACATCAACTCTTCACTTGGGTGG - Exonic
956651779 3:71510673-71510695 AGTTGAACATTGCAGTTGGTAGG - Intronic
957261251 3:77904864-77904886 CCATGAACCTTGCAGTGGGTGGG - Intergenic
964268734 3:154931324-154931346 GGATGAACTTAGCAGTTGGTGGG - Intergenic
967169639 3:186812996-186813018 ATAAGAACTTTGGAATTGGGTGG + Intergenic
968474410 4:796325-796347 ACATGAAGTCTTCAGTGGGGTGG - Intronic
969380524 4:6793927-6793949 ACATGAACTTTTAAGTTGGAAGG - Intronic
969542712 4:7803578-7803600 GCATGGACTCTGCAGTGGGGCGG + Intronic
970371235 4:15408847-15408869 ACATGAATTTTGGTGGTGGGAGG - Intronic
970648481 4:18150514-18150536 AAGTGAACTCTGCAGTTGGAAGG + Intergenic
973010571 4:45067987-45068009 ATATAGACTTGGCAGTTGGGTGG - Intergenic
975651403 4:76597137-76597159 ACATGTACTTGTCAGTAGGGTGG - Intronic
976264456 4:83177231-83177253 ACATGAAGTTTGAAGTTGAGAGG - Intergenic
978811750 4:112856972-112856994 ACAGGAACTTTGCAGAAGGCAGG + Intronic
979025752 4:115572457-115572479 CCATGAACTTTTCAATTAGGTGG - Intergenic
979190466 4:117850193-117850215 CCATAACCTTTGCAGTTTGGTGG - Intergenic
979359291 4:119742833-119742855 ACTTGAACCTGGCAGATGGGAGG - Intergenic
979611580 4:122694695-122694717 CCATGATATTTACAGTTGGGAGG + Intergenic
983161227 4:164417370-164417392 ATATAAACTTTGCATTTGGAAGG - Intergenic
986253316 5:6081198-6081220 ACATCTATTTTGCTGTTGGGTGG - Intergenic
989630750 5:43480684-43480706 TCATGAAATTTGCAGTTAAGTGG - Intronic
1003196719 6:3921208-3921230 ACATGAACTATGGACTTGGGGGG + Intergenic
1005578025 6:27208255-27208277 TCATGATGTTTGCAGCTGGGAGG - Intergenic
1006183729 6:32168853-32168875 CCATGGACTTTGGAGTGGGGGGG + Exonic
1012873311 6:104696634-104696656 ACATGGACTTTACAGTTTGGGGG + Intergenic
1022218567 7:28289948-28289970 ACATGCTCTTGGCAGTTGAGGGG - Intergenic
1022607348 7:31828573-31828595 ACATGAACTTTGCAGTTGGGTGG - Intronic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1026033038 7:66811731-66811753 ACATGAACTCTGAAGCTGGAAGG + Intergenic
1030261247 7:107566048-107566070 AGATGAACTTTGGAGCTGGGAGG - Intronic
1032427098 7:131830985-131831007 ACATGCACTGTGAAGGTGGGAGG - Intergenic
1039034046 8:33340162-33340184 ACACGAACTTTACAATTGGCTGG - Intergenic
1040949697 8:52925061-52925083 TCATGCCCTTTGCAGTGGGGAGG + Intergenic
1042385897 8:68174371-68174393 ACTTGAAGTTTGGTGTTGGGGGG - Intronic
1044234865 8:89819045-89819067 ACTTGAGCTTAGCAGTTGGAAGG + Intergenic
1047900872 8:129421138-129421160 GCATGAACTTTGCAGTCAGGTGG - Intergenic
1049915521 9:314075-314097 ACACGAACTTTGTAGTTAGCGGG - Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051708395 9:19904579-19904601 AAATGATCGTTGCATTTGGGGGG + Intergenic
1055769977 9:79706494-79706516 ACGTGCAATTTGCAGATGGGTGG + Intronic
1056935254 9:90911288-90911310 TCATGATGTTTGCAGCTGGGAGG + Intergenic
1056983818 9:91342385-91342407 ACAGGAACTTCGCAGATGTGAGG - Intronic
1057169659 9:92954019-92954041 ACATTATATTTGCATTTGGGAGG - Intronic
1057497511 9:95572471-95572493 ACATGAACACTGCTGTTGGCTGG + Intergenic
1057695338 9:97318923-97318945 CCATGAGCTTTGCAGTTTGGAGG + Intronic
1058271524 9:102977270-102977292 CCATGAGTTTTGGAGTTGGGGGG + Intergenic
1059096654 9:111423576-111423598 AGATGAACTTTGGTGTTTGGAGG - Intronic
1059613409 9:115923345-115923367 ACATGAATTTTGCAGTTTGGGGG + Intergenic
1059970470 9:119662523-119662545 ACATGAACTGTGCAGATAGCTGG + Intergenic
1062188222 9:135229882-135229904 ACGTGAGCTGTGCAGCTGGGAGG - Intergenic
1186883489 X:13889679-13889701 ACATGAACTTTACAGTTCAGTGG + Intronic
1187132517 X:16516538-16516560 ACATGTATTTTGCATGTGGGAGG + Intergenic
1188489793 X:30725231-30725253 ACATTAACTTTGGGGTTGGAAGG - Intronic
1194103724 X:89740410-89740432 ACATGTACTTTGCAGCTGTTGGG - Intergenic
1195071834 X:101288884-101288906 AAATGAAAGTTGCAGTTAGGGGG - Intronic
1196070589 X:111516957-111516979 ACATGAATTTTGAATATGGGTGG - Intergenic
1196070654 X:111517648-111517670 ACATGAACTTTGAATATGGGTGG + Intergenic
1197269552 X:124410881-124410903 ACATGGACTTTCCAGCTTGGGGG + Intronic
1197296410 X:124724447-124724469 ACATGAAAGTTGAAGTGGGGAGG + Intronic
1198265104 X:135001692-135001714 AGGTGAGCTTTGCAGGTGGGTGG - Intergenic
1200244444 X:154515752-154515774 ACATGAGGTTGGCAGGTGGGTGG - Exonic