ID: 1022607367

View in Genome Browser
Species Human (GRCh38)
Location 7:31828718-31828740
Sequence CAATGGCCACAGGTTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022607367_1022607370 6 Left 1022607367 7:31828718-31828740 CCTGGGTCAACCTGTGGCCATTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1022607370 7:31828747-31828769 TAATGAACTCCTCCCAGATGTGG No data
1022607367_1022607371 7 Left 1022607367 7:31828718-31828740 CCTGGGTCAACCTGTGGCCATTG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1022607371 7:31828748-31828770 AATGAACTCCTCCCAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022607367 Original CRISPR CAATGGCCACAGGTTGACCC AGG (reversed) Intronic
900612320 1:3549354-3549376 CCATGGCCACAGGCAGACCAGGG + Intronic
902418686 1:16259930-16259952 CACTGGCCACATGTTGCCCGTGG + Intronic
903547335 1:24134273-24134295 CGATGGCCACCGGCTAACCCTGG - Exonic
905960132 1:42036017-42036039 CGATGGACCCAGTTTGACCCCGG - Intergenic
908559799 1:65294358-65294380 CAAAGGCCAAAGTTTGATCCTGG + Intronic
909493131 1:76247682-76247704 CAATGGTCCCAGGTTGACTCTGG + Intronic
1067562756 10:47315277-47315299 CCATGCCCACAGCTGGACCCAGG - Intergenic
1069779055 10:70943424-70943446 CACTGGCCCCAGGCTGACACTGG - Intergenic
1072326064 10:94300069-94300091 CAATGGCACCAGGTGGACACAGG - Intronic
1073929241 10:108555384-108555406 CAATGGCCCCAGGTGTACCTTGG - Intergenic
1077015049 11:395665-395687 CAGAGGCCCCAGGTTCACCCTGG - Intronic
1078840910 11:15074901-15074923 CAGTGCCCACAGGTGGACCCTGG + Intronic
1081385476 11:42467204-42467226 CACTGTGCACAGGATGACCCGGG + Intergenic
1081538650 11:44014327-44014349 CAAGGGCCACAGAGTGAGCCTGG - Intergenic
1082944164 11:58740513-58740535 CAATGGCCACAGGTGCACATGGG + Intergenic
1083261768 11:61526973-61526995 CAATGGCCCCCGGTTCAACCAGG - Intronic
1083998534 11:66283913-66283935 CAAGGGGCAGAGCTTGACCCTGG + Exonic
1085731668 11:79005040-79005062 CAATGTCCCCAGATTGAACCAGG + Intronic
1090387630 11:126365912-126365934 AAATGGCCACAGGCTGCCCTGGG + Intronic
1090390195 11:126383110-126383132 AAATGGCCACAGGCTGCCCTGGG + Intronic
1092000162 12:5025090-5025112 CAGTGGCCACAAACTGACCCTGG - Intergenic
1096880966 12:54670049-54670071 CCACGGCCACAGATTGACCATGG - Intergenic
1097842439 12:64334975-64334997 CAATGGCCACAGGTAGCCAATGG + Intronic
1099438995 12:82678222-82678244 CAATGACCAAACGATGACCCAGG - Intergenic
1100472768 12:94908475-94908497 GAATTGCCATAGATTGACCCAGG - Intronic
1102340439 12:112117273-112117295 CAGTGGCCCCAGGGTGACTCAGG - Intergenic
1112016296 13:95334193-95334215 CACAGGCCACAGGTTGGCCCAGG - Intergenic
1112379817 13:98878173-98878195 CCATGTGCACAGCTTGACCCAGG + Intronic
1112690568 13:101889034-101889056 AAAAGACCACAGGTAGACCCAGG + Intronic
1119508956 14:75196378-75196400 CAATGGACACAGGGTCACCTGGG - Intergenic
1119810292 14:77512225-77512247 CAAAGGCCACAGGCTGTCCTGGG + Exonic
1121571466 14:94949744-94949766 CAATGGCCACAACATGCCCCTGG + Intergenic
1122598332 14:102908520-102908542 CCATGGCCCCAGGCTGGCCCAGG - Exonic
1122768047 14:104085224-104085246 CAATGGCCGCAGGATGGCTCAGG + Intergenic
1128451533 15:67808550-67808572 CAATGGGCACAGGCGGCCCCAGG - Intergenic
1132024158 15:98390766-98390788 CAATGGGAAGAGGTTGACCTGGG - Intergenic
1132433954 15:101781724-101781746 CAATTGCCCCAGGTTGACTTTGG - Intergenic
1132935869 16:2480742-2480764 CTAAGGCCACAGGTTTACCAAGG - Intronic
1139921762 16:70464972-70464994 CAATGGCCACAGGCAGACAAGGG - Intronic
1143136286 17:4714495-4714517 TAATGGCCACTGGTTGCCCTAGG - Intronic
1144578360 17:16443890-16443912 CAATGGCAACCGGTTGACCCGGG - Exonic
1150264985 17:63826536-63826558 CACTCGCCACAGGTTGCTCCTGG - Intronic
1152986098 18:322750-322772 CACTGGCCACAGGGTGTCCTCGG + Intronic
1154506027 18:15041669-15041691 AAATGACCACAGGATGACTCTGG - Intergenic
1155465257 18:26127713-26127735 CACAGGCCACAGGTTGTGCCAGG - Intergenic
1157349637 18:46873013-46873035 CAAAGGCCACAGGTTGTCAGTGG - Intronic
1158376341 18:56873583-56873605 CAATGGCCACTGCTTGAAGCGGG - Intronic
1159141140 18:64396534-64396556 GAATGCCCACATGTTGACCCAGG + Intergenic
1160497909 18:79386009-79386031 CATTGGCCTCAGGCTGACCCGGG + Intergenic
1160819432 19:1051143-1051165 CACTGGCCGCAGGCTGACCGTGG + Exonic
1160859558 19:1231906-1231928 GAGTGGCCACATGTTGACCAGGG - Intronic
1160901329 19:1430150-1430172 GACTGGCCACAGTTAGACCCAGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162943946 19:14031318-14031340 CAATGGCCACAGTTTGGACTGGG - Intergenic
1163550729 19:17965328-17965350 CCATGCCCACGGGCTGACCCTGG - Intronic
1165824886 19:38700079-38700101 CAAAGGCCCCAGCTGGACCCTGG - Intronic
1165833340 19:38740354-38740376 CCTGGGCCACAGGGTGACCCTGG - Intronic
1166343022 19:42150127-42150149 CGATGGCCACAGGTTGAGGGAGG - Intronic
1167748302 19:51365757-51365779 CCATAGCCACAGGGTGAGCCAGG - Intronic
1168539509 19:57198570-57198592 AAATGACCACAGGTTGAGTCTGG + Intronic
926810545 2:16751864-16751886 AAATGACCACAGGATGACTCCGG + Intergenic
926926787 2:17995635-17995657 CAGTGGCCACAGGTTGGTTCAGG + Intronic
933087072 2:78067531-78067553 CACTGGCCACGGGCTGTCCCAGG + Intergenic
938140693 2:128792053-128792075 CCAAGGCCACAGGTGGACCTGGG + Intergenic
940972640 2:159910146-159910168 CGATGCCCACAGATTGTCCCAGG + Intergenic
948542942 2:238703022-238703044 CAAAGGCCACACTTTGAGCCTGG + Intergenic
1169671459 20:8107110-8107132 CAATAGCCACAGAGTGAGCCAGG + Intergenic
1171468588 20:25351567-25351589 TATTGGCCTCAAGTTGACCCTGG + Intronic
1173367998 20:42405386-42405408 CAATGAGAACAGGTGGACCCAGG - Intronic
1174093244 20:48066825-48066847 CAATGACTTCAGGTTGACTCTGG + Intergenic
1175274551 20:57759251-57759273 CAATGGCTACAACTTGCCCCAGG + Intergenic
1176791826 21:13327355-13327377 AAATGACCACAGGATGACTCTGG + Intergenic
1176971895 21:15276129-15276151 CAATGGCCAAAAATTGTCCCAGG + Intergenic
1177831122 21:26140282-26140304 CAGTGACCACAACTTGACCCAGG + Intronic
1180786167 22:18549053-18549075 CAATGTCCACACGGTGAACCGGG - Intergenic
1181102845 22:20552917-20552939 CTAAGGCCCCAGGTTGACCCTGG + Intronic
1181131452 22:20734779-20734801 CAATGTCCACACGGTGAACCGGG - Intronic
1181243089 22:21488607-21488629 CAATGTCCACACGGTGAACCGGG - Intergenic
1182923921 22:34105133-34105155 CAATGGCCACAGGGTTGACCTGG + Intergenic
1183539932 22:38423946-38423968 CAAAGGCCACAGGTGCACTCTGG + Intergenic
1184152708 22:42648088-42648110 TGATGCCCACAGGTTCACCCTGG + Intronic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
950211270 3:11125346-11125368 CACTGGCCACAGTTTGTCCTGGG + Intergenic
955550008 3:60073724-60073746 CAAGGGCCACAGGTTGGTCAAGG - Intronic
964640111 3:158900196-158900218 CAGTTGCCACAGTTAGACCCTGG + Intergenic
964806738 3:160618390-160618412 CAATGGCTAGATTTTGACCCGGG + Intergenic
966388743 3:179429310-179429332 CAGTGCCCACAGGGTGACACAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968906775 4:3456770-3456792 AAATGACCACAGGATGAGCCCGG - Intergenic
969170995 4:5363375-5363397 CCAAGGCCACAGGGTGATCCAGG + Intronic
969273826 4:6121282-6121304 CAATGTCCATAGCTTGACCCAGG + Intronic
970829310 4:20317756-20317778 CAAAGGCCAAAGCTTGACCCTGG + Intronic
972805738 4:42528155-42528177 AAATGACCACAGGATGAGCCCGG - Intronic
979912462 4:126385226-126385248 CAATAACCACTGGTTAACCCAGG + Intergenic
985421175 4:189786473-189786495 CAATGGGTAGAGGTTGAGCCTGG - Intergenic
985918880 5:2950488-2950510 CAATAGCATCACGTTGACCCAGG - Intergenic
987198441 5:15550602-15550624 GAATAGCCAGAGGTAGACCCAGG + Intronic
993865615 5:93191080-93191102 CAACTGCCACAAGGTGACCCTGG - Intergenic
995269716 5:110206654-110206676 AAATGGCCACAGGATGAGTCTGG + Intergenic
996489815 5:124080435-124080457 CAATGTCCACAGAATGACTCAGG - Intergenic
999223623 5:150001413-150001435 CATGGGCCACAGTTTGACTCTGG - Intronic
1000759626 5:165206354-165206376 CAATGATGACAGGTTGATCCAGG + Intergenic
1001823071 5:174724874-174724896 CAGTGGCCGCAGGGTGGCCCCGG - Exonic
1002807754 6:593751-593773 CAATGGCTCCAGGCTGACCTTGG + Intronic
1004824449 6:19404427-19404449 AAATGACCACAGGATGACTCTGG + Intergenic
1006527301 6:34617874-34617896 CAATGGGCACAAGTTCACGCAGG + Intronic
1007581612 6:42963375-42963397 CAAGGCCCACATGGTGACCCTGG + Exonic
1008077143 6:47156765-47156787 CACTGGATACAGGCTGACCCAGG + Intergenic
1010370127 6:75097689-75097711 CAATGTCCACAGGCTGGCCCAGG + Intronic
1012225703 6:96700997-96701019 CTATGGCAACAGCTTGACCGGGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1017605795 6:156131453-156131475 CTTGGGCCACAGGGTGACCCTGG - Intergenic
1019256459 7:55452-55474 TAATGGCCACAGGGTGAGCTTGG + Intergenic
1019306984 7:340294-340316 CACTGGCCTGAGGTTGCCCCTGG + Intergenic
1019515145 7:1436586-1436608 CGATGGCCACATGTGGCCCCTGG + Intronic
1019946089 7:4330571-4330593 CAATGGCCACCTGATGTCCCAGG + Intergenic
1019966746 7:4505809-4505831 CAATGGTGACAAGTTGATCCCGG + Intergenic
1022607367 7:31828718-31828740 CAATGGCCACAGGTTGACCCAGG - Intronic
1024225878 7:47326592-47326614 CCATGGCTACAGGTTGGCCAAGG + Intronic
1026059008 7:67009618-67009640 TAATGGCCACAGGCAGATCCAGG - Exonic
1026719080 7:72815424-72815446 TAATGGCCACAGGCAGATCCAGG + Exonic
1032005817 7:128301312-128301334 CAAAGGACAGAGGATGACCCTGG - Exonic
1033955245 7:146839749-146839771 CAATGGCTTCAGGTTGACTTTGG + Exonic
1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG + Intronic
1035855054 8:2965447-2965469 CTAGGGTCACAGGTTTACCCAGG + Intronic
1037126894 8:15362475-15362497 CAGTAGCTACAGGTTGACCTGGG + Intergenic
1040036141 8:42871967-42871989 CAATGGCCACATGTGGCTCCTGG - Intronic
1040280459 8:46039406-46039428 CACTGTCCACTGGTTGACCGGGG + Intergenic
1040717304 8:50272612-50272634 CAATGGCCACAGGATACCCGTGG + Intronic
1041015560 8:53590229-53590251 CAATGGCCACAAGTTTTGCCTGG - Intergenic
1041364988 8:57092510-57092532 CAGTGGCCACCTGCTGACCCTGG - Intergenic
1043260131 8:78185362-78185384 AAATGGCCACAGGATGAGTCAGG + Intergenic
1046585928 8:116148831-116148853 AAATGACCACAGGATGAGCCTGG + Intergenic
1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG + Intronic
1060030677 9:120212401-120212423 CTTTGGCCACTGGTTGACCCAGG - Intergenic
1060400168 9:123344051-123344073 CACTGGCCACAGGCTGTCCCTGG + Intergenic
1061391438 9:130319338-130319360 CACTCAGCACAGGTTGACCCTGG + Intronic
1186039820 X:5463499-5463521 CAATGGCCACAGCTACAACCAGG - Intergenic
1187699897 X:21955357-21955379 CAGAGGACACAGGTTGGCCCTGG - Intronic
1188101438 X:26092932-26092954 CATTGGCTACAGGCTGACTCAGG + Intergenic
1191128132 X:56979920-56979942 CAATGGTCATAGGTAGACACTGG - Intronic
1191226587 X:58050490-58050512 AAATGACCACAGGTTGAGTCCGG - Intergenic
1195175725 X:102313606-102313628 CAATACCCACAGGTTGACCAGGG - Intronic
1195183139 X:102373487-102373509 CAATACCCACAGGTTGACCAGGG + Intronic
1195869241 X:109469018-109469040 CAGTGACCACCTGTTGACCCAGG - Intronic
1196966511 X:121062549-121062571 CAATGTCCAAAGATTGAACCAGG - Intergenic
1198933862 X:141886653-141886675 AAATGGCCACAGGATGAGTCCGG - Intronic
1201547144 Y:15178091-15178113 CAATGGCCACAGCTACAACCAGG + Intergenic