ID: 1022612870

View in Genome Browser
Species Human (GRCh38)
Location 7:31894819-31894841
Sequence CTCCCTGGGGGTTCTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022612870_1022612875 -10 Left 1022612870 7:31894819-31894841 CCACCACGAGAACCCCCAGGGAG 0: 1
1: 0
2: 2
3: 18
4: 117
Right 1022612875 7:31894832-31894854 CCCCAGGGAGCAGTGGAAAGAGG No data
1022612870_1022612878 -1 Left 1022612870 7:31894819-31894841 CCACCACGAGAACCCCCAGGGAG 0: 1
1: 0
2: 2
3: 18
4: 117
Right 1022612878 7:31894841-31894863 GCAGTGGAAAGAGGAATCTCAGG 0: 1
1: 0
2: 0
3: 23
4: 281
1022612870_1022612879 6 Left 1022612870 7:31894819-31894841 CCACCACGAGAACCCCCAGGGAG 0: 1
1: 0
2: 2
3: 18
4: 117
Right 1022612879 7:31894848-31894870 AAAGAGGAATCTCAGGAAAGTGG 0: 1
1: 1
2: 4
3: 87
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022612870 Original CRISPR CTCCCTGGGGGTTCTCGTGG TGG (reversed) Intronic
900548537 1:3241982-3242004 CTGCCTGGGAGTGATCGTGGGGG + Intronic
903068982 1:20717408-20717430 CCCCCTGGGGACTCTCGGGGCGG + Intronic
903348702 1:22704583-22704605 CTCCCTGATGGTTCTCCTAGAGG + Intergenic
904042652 1:27593402-27593424 CTGCCTGGGGGTAGTGGTGGCGG - Intronic
905525963 1:38639827-38639849 CTCCCTTGCTGTTCTCGTGATGG - Intergenic
905652420 1:39665458-39665480 ATCCCTGGGGGGTCTGGTAGGGG + Intronic
909880146 1:80865359-80865381 ATCTCTGGGGGTTCTGGTGCAGG - Intergenic
912177573 1:107179071-107179093 CTCCCTGGGTCTTCTCTTTGTGG - Intronic
915491292 1:156251332-156251354 CTCCCTAGGAATGCTCGTGGAGG + Intronic
915589019 1:156860263-156860285 CACCCTGTGGCTTCTCTTGGAGG + Intronic
916037747 1:160936011-160936033 CTCCCTGGAGCTTCTGGTGGTGG + Intergenic
918453693 1:184685629-184685651 CTCCTGGAGGGTTCTAGTGGTGG - Intergenic
920021752 1:202961662-202961684 CTCCCTGGAGGCTCTCGAGGTGG - Intergenic
921163462 1:212489104-212489126 CTCCCTGGGGGCAGACGTGGAGG - Intergenic
922930150 1:229382460-229382482 CTCCCTGGGGGTCCCCTTGCTGG - Intergenic
923791076 1:237111811-237111833 CTCCTTGAGGGTTCTAGTGCAGG + Intronic
1066204987 10:33180231-33180253 TGCCCTGGGGGTCCTCCTGGGGG - Exonic
1070380490 10:75876643-75876665 CTCCCAGGGGCTTCTGGTGCAGG + Intronic
1070783494 10:79150380-79150402 CTCCCTGGGCCTCCCCGTGGTGG + Intronic
1070983293 10:80667162-80667184 GTCCCTGGGGGTCCTCATGGAGG + Intergenic
1071525242 10:86354539-86354561 CTGCCTTGGGGTTGTGGTGGTGG - Intronic
1074979854 10:118610732-118610754 CTCCCTGGCTGGTCTCATGGGGG - Intergenic
1075256959 10:120932969-120932991 CTCTCTGCAGGTTCTAGTGGGGG - Intergenic
1076996613 11:300124-300146 GTCCCTGGGGGTTCCCCTGCCGG - Intergenic
1083158696 11:60841572-60841594 CTACCTGGGGGTCCTGGAGGTGG - Intergenic
1083267157 11:61551960-61551982 CTGTCTGGGGGTTCTCTGGGGGG + Intronic
1083821580 11:65174419-65174441 CCTTCTGGGGTTTCTCGTGGCGG - Intergenic
1084797569 11:71518865-71518887 CTCCTGGGGGCTTCCCGTGGGGG + Intronic
1085340085 11:75725711-75725733 CTCCCTGAGGGTTCTTGTTGGGG - Intronic
1085604211 11:77882690-77882712 CCCCTTTGGGGTTCTAGTGGTGG - Intronic
1086283577 11:85219518-85219540 CTCCCTGAGGGTTCTAGAGGAGG + Intronic
1089257104 11:117199807-117199829 CTCCTTGGAAGTTCTCCTGGAGG - Intronic
1097889027 12:64759156-64759178 CTGCCTGGGGGTCTTCGGGGTGG - Exonic
1101968856 12:109298711-109298733 CTCCCAGGGGGTTCACCTGCAGG - Intronic
1102466913 12:113135426-113135448 CTCCCTGAATGTTCGCGTGGTGG - Exonic
1102813494 12:115843855-115843877 CTCCCTAGGGTTTTTGGTGGGGG + Intergenic
1103342769 12:120229936-120229958 CTGCCTGGGGCTGCTGGTGGAGG - Intronic
1107425928 13:40292882-40292904 CTACCTGAGGGATCCCGTGGGGG - Intergenic
1118315195 14:64721786-64721808 CACCCTAGGGGCTCTCCTGGGGG - Intronic
1120396684 14:83975952-83975974 CTTCCTGGGTTTTCTCTTGGGGG - Intergenic
1120875881 14:89375080-89375102 CTGCCTGAGGGTTTTGGTGGAGG + Intronic
1127361070 15:58245662-58245684 CTCCCTGGGAGATCCCATGGTGG - Intronic
1127831881 15:62758173-62758195 CTCCCTCGTGCTTCTCTTGGTGG - Intronic
1128157990 15:65403861-65403883 CTCCATGGGGGTTGGGGTGGTGG + Intronic
1131176205 15:90211268-90211290 CTGCCTGGGGGTTCTGGCAGAGG + Intronic
1132556515 16:575086-575108 CTGCCTGGGGGTGCTCCTGAGGG + Intronic
1132598966 16:765474-765496 CTCTCTGGGGCTGCACGTGGGGG + Intronic
1133207155 16:4240607-4240629 CTCGCTGGGGGCTCTTGTCGTGG - Intronic
1136115775 16:28093468-28093490 CTGCCTGCAGGTTCTCATGGTGG + Intergenic
1136136202 16:28258375-28258397 CTTCCTGGGGGTACATGTGGAGG + Intergenic
1136386005 16:29926290-29926312 CTCGCTGGGGGATCCCGTAGAGG + Exonic
1139530074 16:67538405-67538427 CTCCCTGCGGGTGATCGGGGGGG - Exonic
1140744941 16:77973077-77973099 CTCCCTGGGGCCTCTCGAGGAGG + Intronic
1147253052 17:39165200-39165222 CTTCCTGGGAGGTCTGGTGGGGG - Intronic
1147402164 17:40187317-40187339 CTCCCTAAGGGTTGTGGTGGTGG - Intronic
1148002830 17:44399864-44399886 CTCCCAGGGGGTTCTGGTTTGGG + Exonic
1148214910 17:45829274-45829296 CTCCCTGGTGGCCCTCCTGGTGG + Exonic
1150620800 17:66806578-66806600 CTCTCTGGGGGGCCTCGTGGGGG - Exonic
1154334194 18:13452885-13452907 CTTCCTGGAGGTTCTCGCTGGGG - Intronic
1157444026 18:47731459-47731481 TTCCCTGGGGGTACTGTTGGAGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158719189 18:59908709-59908731 CTCCCGGAGGGATCTTGTGGTGG + Intergenic
1160502073 18:79406715-79406737 CTCCTGGGGGGTTCCCGTTGAGG - Intronic
1160529864 18:79556717-79556739 CTCCTGGGGGGTTCTGGAGGAGG - Intergenic
1161373587 19:3927558-3927580 CCCCCTGGAGTTTCTGGTGGGGG - Exonic
1162028075 19:7905370-7905392 CTCCTTGGGGAGTCTCTTGGGGG + Intronic
1162154956 19:8671376-8671398 CTCCCTCTGGGTTCCTGTGGAGG + Intergenic
1162472497 19:10880829-10880851 CTCCCTGGAGGTTTTCGTGGAGG + Intronic
1162479541 19:10920583-10920605 CTCCCTGGGGCTGGTGGTGGTGG + Intronic
1164541798 19:29127008-29127030 CTCCCTTGGGGTTCTGGAGCAGG - Intergenic
1164589557 19:29499122-29499144 CTCTGTGGGGGTTCTCGTGCCGG - Intergenic
925966595 2:9072388-9072410 CTCCCTGTGTCTTCACGTGGGGG - Intergenic
929242389 2:39666025-39666047 CTCCCTGGGGCTGCTCGTCACGG + Exonic
929589587 2:43136206-43136228 CTCCCAGGGTGGGCTCGTGGGGG - Intergenic
929863449 2:45698427-45698449 CTCCCTGGGGGTTGTGGATGGGG + Intronic
931345300 2:61440303-61440325 CTCCCTGGTGGTCCTGCTGGAGG + Intronic
932800115 2:74734186-74734208 CTCCCTGGGGGTATTCATGGTGG - Intergenic
933313258 2:80686367-80686389 CTCCTTTGGGGTTCTCTTAGAGG + Intergenic
944584082 2:201158278-201158300 CTCCCTGGAGGTTCTGGCTGGGG - Intronic
945047509 2:205794881-205794903 CTCACTGGGCGTCCTCCTGGGGG + Exonic
949017091 2:241719636-241719658 GGCACTGGGGGTCCTCGTGGGGG + Intronic
1172671054 20:36634687-36634709 CTCCCTCAGGGTGCTTGTGGAGG - Intronic
1172793070 20:37519579-37519601 CTCCCCGGGGCTTCTCCTGGGGG + Intronic
1173036723 20:39418756-39418778 GTCCATGGGGATTCTGGTGGAGG + Intergenic
1175583794 20:60121415-60121437 CTCCCAGGGGCTACTGGTGGGGG + Intergenic
1179218428 21:39386430-39386452 CTCCAGTGGGGCTCTCGTGGGGG + Intronic
1179337882 21:40474853-40474875 CTCCCTCGCAGTTCTCGTCGTGG - Intronic
1179606568 21:42519611-42519633 CTGCCAGGGGGTTGGCGTGGAGG - Intronic
1181122578 22:20681781-20681803 CTGCCTCTGGGTTCTCCTGGAGG + Intergenic
1181179846 22:21059304-21059326 CTGCCTCTGGGTTCTCCTGGAGG - Intronic
1184377603 22:44124543-44124565 CTCCCTGGGGGCTGTCCTGGAGG + Intronic
949095949 3:85755-85777 CTCCCTGGAGGTTCTCCAGTTGG - Intergenic
952787997 3:37175686-37175708 TTCCCTGGGGGTGCTCGTCCTGG + Intronic
953740590 3:45535415-45535437 CTCCTTGGTGGTGCTCGTGTTGG + Intronic
954613861 3:51959728-51959750 TTCCCTGGGGGTCATGGTGGGGG - Intronic
957710437 3:83850940-83850962 CTCCCTGGGGATTTTTGTGGAGG + Intergenic
967490378 3:190083812-190083834 CTCCCTGGTGGCTCCCATGGGGG + Intronic
967984050 3:195082342-195082364 CTCCCTGGTGGTCTTCCTGGAGG + Intronic
968748020 4:2370962-2370984 TTCCCTGGGGGTCTTCGTGGTGG - Intronic
969111900 4:4849560-4849582 CTCCCTGGGTTTTCTGGTGGAGG - Intergenic
971179181 4:24311993-24312015 TTTCCTGTGGGTTCCCGTGGGGG - Intergenic
986756365 5:10840088-10840110 CTCCCTGTGGCTTGTGGTGGTGG + Intergenic
987297246 5:16564675-16564697 ATCCCTGGTGCTTCTCGTGGAGG - Intronic
987385643 5:17326735-17326757 CTCCCTGGGGACTCTGTTGGAGG + Intergenic
994934615 5:106238209-106238231 CTCCTTGGCAGTTCTCTTGGTGG + Intergenic
1001819444 5:174698568-174698590 CTCTCTGGGGCTTCTGCTGGTGG + Intergenic
1003187983 6:3849423-3849445 CTCGTGGGTGGTTCTCGTGGAGG + Exonic
1005340902 6:24843010-24843032 CTCTCTGAGGGTTCTGTTGGTGG - Exonic
1006288757 6:33117659-33117681 CTCCCTGGGTGGTCTCATGTAGG - Intergenic
1006816370 6:36853180-36853202 CTCTCTGCTGCTTCTCGTGGGGG - Intergenic
1007601742 6:43086344-43086366 CTCCCTGGGGGTGGTTATGGGGG + Intronic
1015717184 6:136205022-136205044 CTCCCTTGGGGTTCTTGCCGTGG - Intergenic
1018704009 6:166450142-166450164 CTCCCTGGTGGTCCCTGTGGTGG - Intronic
1018857858 6:167688310-167688332 CTTCATGGGGGTCCTCCTGGAGG + Intergenic
1019014768 6:168871869-168871891 CTGGCTGGGTGTTCTCCTGGGGG - Intergenic
1019277730 7:184678-184700 TTCCCTGGGGGTCCCCGTGCTGG - Intergenic
1019647880 7:2140643-2140665 CTCCTTGGGGTTTCTCCTGGCGG - Intronic
1021857083 7:24867491-24867513 TTCCCATGGTGTTCTCGTGGTGG + Intronic
1022138575 7:27472531-27472553 CTCCCTGGGGGATGGCGGGGGGG - Intergenic
1022612870 7:31894819-31894841 CTCCCTGGGGGTTCTCGTGGTGG - Intronic
1023913660 7:44572632-44572654 CTCCCTGGAGCTTTTGGTGGTGG - Exonic
1032087364 7:128891136-128891158 CTCCCTGGGGGTCCCCTCGGAGG - Intronic
1032342647 7:131089726-131089748 CTCCCTGGGTCCTCACGTGGTGG - Intergenic
1034270082 7:149799524-149799546 CTCCCTGTGAGTTCTGATGGAGG - Intergenic
1035282915 7:157788607-157788629 CTCCATGTGGCTTCTCATGGTGG - Intronic
1037876814 8:22552500-22552522 TTCCCTGGAGGTTCCTGTGGTGG + Intronic
1043388056 8:79767669-79767691 CTCCCTGGGGGTTCCTGGGGAGG + Exonic
1051582594 9:18694128-18694150 CTCCCTTGCTGTTCTCGTGATGG - Intronic
1057880658 9:98790502-98790524 CTCACTGTGGCTTCTCGGGGCGG - Exonic
1057912814 9:99033520-99033542 CTCCCTGTGGTTTCTCTTGATGG + Intronic
1061837947 9:133341700-133341722 CTCCCTGGGGTTTCTGGTGGTGG - Intronic
1062034446 9:134376693-134376715 CTCCCTGGCTGTGCTCCTGGGGG + Intronic
1185706694 X:2272794-2272816 CTGCCTGGGGGGTCTCCTGTGGG - Intronic
1187519615 X:20001987-20002009 CTCCCTGGTGGTTAACGTGGGGG + Intergenic
1189355735 X:40308658-40308680 CTCTCTGGAGGCTCTCGGGGAGG + Intergenic
1190901043 X:54673270-54673292 CCTCCTGGGGTTTCTAGTGGTGG + Intergenic
1197759949 X:130021016-130021038 CCCCCTGGGGCTTTTCTTGGTGG - Exonic
1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG + Intronic