ID: 1022616350

View in Genome Browser
Species Human (GRCh38)
Location 7:31934742-31934764
Sequence CTGACCTTGAGTAAAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022616350_1022616352 16 Left 1022616350 7:31934742-31934764 CCAGAAATTTTACTCAAGGTCAG 0: 1
1: 0
2: 2
3: 22
4: 179
Right 1022616352 7:31934781-31934803 TCTGTGAGTCACTGATGCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022616350 Original CRISPR CTGACCTTGAGTAAAATTTC TGG (reversed) Intronic
900329993 1:2129306-2129328 CTCACCTTGAGAAAAATATCAGG + Intronic
901576346 1:10204226-10204248 CTGACCTTGGTTAAAATAACTGG + Intergenic
904102941 1:28048656-28048678 TCTACCTTGAGTAAAAATTCTGG - Intronic
907230972 1:52998255-52998277 ATAACCTGGAGCAAAATTTCTGG + Intronic
907520201 1:55018784-55018806 ATGACCTTGAGGAAAATTGGAGG + Intergenic
910552642 1:88493885-88493907 TTGACCTGGAGAAATATTTCAGG - Intergenic
911571062 1:99517530-99517552 CTGTCCTTGAGAAAACTTCCTGG - Intergenic
911773473 1:101777481-101777503 CTAACAATGAGTAAACTTTCAGG - Intergenic
913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG + Intronic
913570481 1:120115041-120115063 CTGACCTTGTGTGAAAGTGCTGG - Intergenic
914454525 1:147823517-147823539 CTGTCCCTGAGTCACATTTCAGG + Intergenic
919194566 1:194266242-194266264 CTGACATTTAGCAAAATTTCTGG - Intergenic
919575246 1:199300424-199300446 CTGATCTTGAGAAAACTTTGCGG - Intergenic
924315979 1:242797091-242797113 CTGAGCGTGAGTGAATTTTCTGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1067467071 10:46509078-46509100 CTGACCCTGAGAAAAACTTCAGG + Intergenic
1067620115 10:47875527-47875549 CTGACCCTGAGAAAAACTTCAGG - Intergenic
1068771625 10:60828037-60828059 TTGACCTTGAGTCAAATGTCTGG + Intergenic
1072064371 10:91851531-91851553 GTGAACCTAAGTAAAATTTCTGG + Intronic
1072757864 10:98032264-98032286 CACACCTTGAGTATACTTTCAGG + Intergenic
1072795449 10:98351363-98351385 CTGACCTGGTGTCAAATTCCTGG + Intergenic
1073419364 10:103411963-103411985 CTGGCCTTGAGTAAACTTTCTGG + Intronic
1074109837 10:110414987-110415009 CTGACGTTGATTAGAATTGCTGG + Intergenic
1074201462 10:111239815-111239837 CTGCCCTTTAGTAAAAAATCTGG + Intergenic
1076355330 10:129848387-129848409 CTAACCTTGGGTAACCTTTCGGG + Exonic
1080876407 11:36278921-36278943 CTGACCTTCAGTTAACTTTCTGG + Intronic
1087511247 11:99097383-99097405 CTGCCCTAGAGAAAATTTTCAGG - Intronic
1087707615 11:101512674-101512696 CTGAACTTGAGAAAACTTTGGGG + Intronic
1088177322 11:107068411-107068433 CTGGTCTTGAGTAAGATTTAGGG + Intergenic
1090708825 11:129366605-129366627 TTGAGCTATAGTAAAATTTCTGG + Intergenic
1094131227 12:27077824-27077846 CTGTTCTTTAGTAAGATTTCTGG - Intergenic
1095265534 12:40152840-40152862 CTGATCTTGAGTTAACTTTTGGG + Intergenic
1096328860 12:50691134-50691156 CTGACCTTCAGAATAATTGCAGG - Exonic
1096962962 12:55598779-55598801 CTGACCCTGAGTAACATACCTGG + Intergenic
1097795185 12:63853770-63853792 CTGGCCTTTGGTAAATTTTCAGG + Intronic
1099240238 12:80129732-80129754 GTGACTATGAATAAAATTTCAGG - Intergenic
1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG + Intronic
1100181576 12:92091927-92091949 CTGTCCTTGAGTGTAATTACTGG + Intronic
1100733076 12:97495420-97495442 CTGAACATAAGTAAAATTCCAGG + Intergenic
1101383652 12:104236492-104236514 CTGAGCTTAATTAAAAGTTCAGG + Intronic
1101665002 12:106804774-106804796 CTGACCTTGAATTATATTTATGG - Intronic
1107667241 13:42704044-42704066 TTGACCATCAGTAAAATTTTGGG + Intergenic
1108692621 13:52873018-52873040 CTGTCCCTGAGTATAATTTGGGG - Intergenic
1109490205 13:63087860-63087882 CTGACCTTAAGTAAAAACTACGG + Intergenic
1110467335 13:75816698-75816720 TTGAACTTGAGAAAAATATCAGG + Intronic
1110873318 13:80478832-80478854 CTGACCTTGAGCAAAATGCCTGG - Intergenic
1114210921 14:20613942-20613964 GTTAGCTTGAGTAAAATTCCAGG + Intergenic
1117205837 14:53442896-53442918 TTGACCCTGAGGAAAATTTGGGG + Intergenic
1118785620 14:69043349-69043371 CTGTCCTTAAGCAAAATGTCGGG - Intergenic
1118945980 14:70387858-70387880 CTGCCCTTGAGGAAATATTCTGG + Intronic
1118949107 14:70417978-70418000 CTGAACTTGAATGAAACTTCAGG + Intergenic
1120167174 14:81213750-81213772 TTTACCTTGAGAAAAATTACAGG - Intronic
1120475294 14:84979079-84979101 TTGACCTTGAGTGCAATTCCAGG - Intergenic
1120612222 14:86656188-86656210 CTGACCTACTGCAAAATTTCAGG + Intergenic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1123927440 15:25131348-25131370 CTTACCTTATGTAATATTTCTGG + Intergenic
1124451207 15:29792969-29792991 CTGAGGTTTAGTAAAATTGCAGG - Intronic
1125328455 15:38560519-38560541 CTGACCTTGTGTAGTATCTCAGG - Intronic
1126878401 15:53068748-53068770 CTGACCTTGAATGACATTGCCGG - Intergenic
1128076143 15:64826915-64826937 GTGACCTTCAGTAAAATCTCTGG - Intergenic
1129128487 15:73467254-73467276 CTGACATTGATTAGAATTACTGG + Intronic
1131267294 15:90924211-90924233 CTGACCCTAAGTAAAATTGAGGG - Intergenic
1135112909 16:19704636-19704658 CTGACCTTGAGCAACACTACAGG - Exonic
1135640350 16:24114479-24114501 GTGACCTTGAGTTACATTGCTGG + Intronic
1137566350 16:49535013-49535035 CTGACCTTCATGAAAATCTCAGG - Intronic
1138163741 16:54780399-54780421 CTGAGCTTGAAAAAAAATTCAGG + Intergenic
1138899685 16:61253808-61253830 CTGAACTTGCGTAGAAATTCTGG + Intergenic
1138926533 16:61598396-61598418 CTTACCTGGAGAAAATTTTCTGG + Intergenic
1139210752 16:65074308-65074330 CTGCCCTTCAGTAAAACTGCAGG + Intronic
1146785573 17:35717897-35717919 CTGAACTAAAGTAAAACTTCTGG + Intronic
1148569470 17:48656699-48656721 CTGACCTTGATTTATATTTCTGG + Intergenic
1151054984 17:71020597-71020619 CTGAGAATGAGAAAAATTTCAGG - Intergenic
1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG + Intergenic
1153653731 18:7263778-7263800 CTGACCCTTTGTAAAATTTGAGG - Intergenic
1155134407 18:22974031-22974053 CTTACACTGAGTAAATTTTCTGG - Intronic
1158274968 18:55757190-55757212 CTGACTTTGAATAAGAATTCAGG + Intergenic
1159111402 18:64060831-64060853 CTAAACTTTAGTAAAGTTTCAGG - Intergenic
1159215323 18:65384412-65384434 GTTACCTTGAGTGAAATTGCTGG - Intergenic
1159233103 18:65634608-65634630 CAGACCTTGAGCCACATTTCTGG + Intergenic
1159479688 18:68972710-68972732 CTGAACTGGATTAAAATTTTAGG + Intronic
1159567765 18:70073448-70073470 CTGCCCTTAAGCACAATTTCAGG + Intronic
1159674429 18:71264081-71264103 CTTACCTTGAGAAAAATTGGGGG + Intergenic
1159909176 18:74127786-74127808 CTGACCTTGATGACCATTTCAGG + Intronic
1159994368 18:74949283-74949305 CTGACCATGAGCAAAATGCCTGG - Intronic
1163753709 19:19093974-19093996 CTGACCGTGAGAAAAACATCAGG - Intronic
1166479325 19:43156165-43156187 CTGACCTAGACTAAAAGATCAGG + Intronic
1168018353 19:53591548-53591570 ATCAACTTCAGTAAAATTTCAGG - Intergenic
926379577 2:12272671-12272693 CTAACCTTGGGTTAAATGTCAGG - Intergenic
926483622 2:13428752-13428774 CTGAGCTTCAGTGAAATTTAAGG + Intergenic
926810897 2:16754675-16754697 CTGACTCTGCCTAAAATTTCAGG + Intergenic
927624352 2:24698563-24698585 CTGAACTTCTGTAAACTTTCTGG - Intronic
927750432 2:25664715-25664737 CTGAGCTTGAGGAGATTTTCAGG + Intronic
930419317 2:51130948-51130970 CTGACATTGATTAGAATTGCTGG - Intergenic
933021065 2:77192909-77192931 CTGATTTTCAGTCAAATTTCTGG + Intronic
933372159 2:81428359-81428381 CTGACCCTCAGTAAAAGTCCTGG + Intergenic
937212421 2:120283541-120283563 CTGACTTTGAGAAAAATTGGAGG + Intronic
937411325 2:121679097-121679119 CTGATCTTGAGAGAAATTTAGGG - Intergenic
939110762 2:138004111-138004133 CTGTCTTTGAGAAAAATTTAAGG + Intronic
941994984 2:171593828-171593850 CATACCTAGAGTAATATTTCTGG - Intergenic
942877945 2:180825236-180825258 CTGGCCTTGAGTCAGATATCTGG + Intergenic
942885693 2:180920641-180920663 ATGCCCTGGAGTACAATTTCTGG - Intergenic
942890862 2:180985941-180985963 GTGACCTTGAGGAAACATTCCGG - Intronic
943937322 2:193936467-193936489 CTGAAGTTCAGTAATATTTCAGG - Intergenic
944136195 2:196402325-196402347 CAGACCTTGAGTTTCATTTCTGG + Intronic
944857070 2:203778345-203778367 CTCACCTGGAATAAAATTTTGGG - Intergenic
945494109 2:210489319-210489341 CTGACCTTGCTTTGAATTTCTGG + Intronic
947366868 2:229405725-229405747 CAGACCTTCAGGAAAATTTCTGG + Intronic
1169499650 20:6147243-6147265 CTGACATTGGGTAAAAATTAAGG - Intergenic
1169546917 20:6659984-6660006 GTGACCTTGAAAAAAAATTCTGG + Intergenic
1170452580 20:16499431-16499453 TTGACCTTGGGTTAACTTTCTGG - Intronic
1173484902 20:43433806-43433828 CTCACTTTGAGAATAATTTCTGG - Intergenic
1177535109 21:22415655-22415677 TTGACTTTGAGCAAAATTTCAGG - Intergenic
1178917585 21:36716947-36716969 CTGACCTTAAGTCAAAATTATGG - Intronic
1181490408 22:23257747-23257769 CTGAACTTGGGTAGCATTTCAGG + Intronic
1181982699 22:26777037-26777059 ATGACCTGGTGTATAATTTCAGG + Intergenic
1182683723 22:32103972-32103994 ATGACCTTGGGTTAACTTTCTGG - Intronic
1183904053 22:41026799-41026821 CTGACCATTAGTCCAATTTCAGG - Intergenic
950972738 3:17204966-17204988 CTGACCTTGAGTACGTTTACTGG + Intronic
951421588 3:22492524-22492546 CTGACATTGTTTAAAATTGCTGG - Intergenic
952740953 3:36733801-36733823 GTGCCCTAGAGTAAAATTTTAGG - Intronic
954097721 3:48343025-48343047 CTGAACTTGATTAAAAATTGAGG + Intergenic
956441891 3:69288671-69288693 CAGAACTTGAGGAAAACTTCGGG - Intronic
957565080 3:81875185-81875207 GTGAACTTGACTAAAATTTCAGG + Intergenic
958844572 3:99250816-99250838 CTGACCTTGACTTACATTACAGG - Intergenic
962966389 3:140358219-140358241 CTGTCCTTGGGAAAACTTTCTGG + Intronic
964066002 3:152580200-152580222 TTGACATTGAGGGAAATTTCAGG + Intergenic
964361691 3:155904754-155904776 CTCATCTTGAGAAACATTTCAGG + Intronic
965417267 3:168412405-168412427 ATGACTGTGAGTACAATTTCAGG - Intergenic
965676998 3:171208028-171208050 CTGAACTTAAGAGAAATTTCAGG + Intronic
967377036 3:188816026-188816048 TTTACATTGAGTAAAGTTTCTGG + Intronic
974466214 4:62259773-62259795 CTGACCCTGAGTAAAATTTTGGG - Intergenic
975274624 4:72482133-72482155 ATGCCCTAGAGTGAAATTTCTGG - Intronic
975715979 4:77206244-77206266 CTGACCCTGAGCATAATTTTGGG + Intronic
976006585 4:80437565-80437587 CTGCCCTTTATTAAAATTTTGGG - Intronic
976059782 4:81113634-81113656 CTGACCCAGAGAGAAATTTCTGG - Intronic
976987371 4:91318438-91318460 CTGAGTTTGAGTGAAATTCCTGG + Intronic
977664598 4:99631390-99631412 CAGTCATGGAGTAAAATTTCAGG + Intergenic
977750176 4:100600722-100600744 TTGACCTTAAGAAAAATTTTAGG + Intronic
977799775 4:101213142-101213164 ATGACTTTGATTAAAATTTCTGG - Intronic
978871068 4:113578633-113578655 ACAAACTTGAGTAAAATTTCTGG - Intronic
979701610 4:123674487-123674509 CTGACCTTTAGGACAATGTCAGG + Intergenic
980793712 4:137653759-137653781 CTGCCCTTGATTAAAATAGCAGG - Intergenic
988276264 5:29084532-29084554 GCAACCTTGATTAAAATTTCTGG - Intergenic
989250611 5:39310174-39310196 CTGACCTTGGGGAGAATATCAGG + Intronic
989270171 5:39523739-39523761 CTGATATTGAGCACAATTTCTGG - Intergenic
989518116 5:42367228-42367250 CTGACCTTAAGAATAATTTCTGG - Intergenic
991670260 5:69040272-69040294 CTGACCCTTTGTAAAATTTTTGG - Intergenic
993475799 5:88362436-88362458 CTGAACTTGACCAAAATGTCAGG - Intergenic
993821010 5:92617041-92617063 CAGACTTTTATTAAAATTTCAGG + Intergenic
993923251 5:93832897-93832919 CTGACCTTCAGTTGACTTTCTGG - Intronic
995322016 5:110845510-110845532 ATGACCTTTAGTCACATTTCAGG + Intergenic
996749686 5:126876009-126876031 CTGCCCGTGAGAAACATTTCTGG + Intronic
997214832 5:132101964-132101986 CTTCCCTTGAGTAGATTTTCTGG + Intergenic
997811789 5:136977864-136977886 CAGACCTGGAACAAAATTTCTGG - Exonic
998068564 5:139178583-139178605 AGGACGTTGAGGAAAATTTCAGG - Intronic
998796014 5:145819940-145819962 CTTACCTTCCTTAAAATTTCTGG + Exonic
1000274981 5:159725990-159726012 CTGACCTAGCCTAAAAGTTCAGG - Intergenic
1003696955 6:8416904-8416926 CTGGCTTTGATTAAAATTTTTGG - Exonic
1004171818 6:13301055-13301077 CTGAGCTTCTGTAACATTTCAGG - Intronic
1005811026 6:29516802-29516824 TTCAGCTTGTGTAAAATTTCGGG - Intergenic
1009698621 6:67144108-67144130 ATGTCCAGGAGTAAAATTTCTGG + Intergenic
1011548192 6:88503165-88503187 CTGACCTTTAGAAAGATTACAGG - Intergenic
1011874301 6:91938220-91938242 CTTACCTTTAGTGATATTTCAGG - Intergenic
1012943024 6:105436484-105436506 CTAACCTGGAATAAAATTTCTGG + Intergenic
1013297187 6:108768161-108768183 GTGACCTTGAGCAAAATCTCTGG + Intergenic
1014455284 6:121626301-121626323 CTGGCCTTGATTAAGATTTAGGG + Intergenic
1015060287 6:128956161-128956183 ATGCCCTTGAGTAAAATTGATGG - Intronic
1016138029 6:140570789-140570811 TTGACCTTGTTTAAAATCTCAGG - Intergenic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1023006754 7:35878490-35878512 CTGGCCTTTAGTAAGATTTTTGG + Intronic
1023112833 7:36831349-36831371 CTGACCTTGGCTAAAATCCCTGG + Intergenic
1030339212 7:108357990-108358012 CTGACAATGTGTAAAATCTCAGG + Intronic
1031211070 7:118827156-118827178 CTGACCTTGATTCTAAATTCTGG + Intergenic
1031728359 7:125265177-125265199 GTGAACATAAGTAAAATTTCAGG + Intergenic
1033390976 7:140927024-140927046 CTGACCTTGCCTTAAAATTCTGG + Intergenic
1034181581 7:149142815-149142837 CTGACTTTGAGAAAAATTTGTGG + Intronic
1034758821 7:153651237-153651259 CTGACTTTGCAAAAAATTTCAGG - Intergenic
1036824521 8:11965769-11965791 CTGACCTTGTCTAGAATTGCTGG + Intergenic
1038516179 8:28189414-28189436 CTGAGCTTGAGTTAAAAATCAGG + Intronic
1039429318 8:37513246-37513268 CTCACCTTGAGTACAATCTCCGG + Intergenic
1042485840 8:69344847-69344869 CAGACCTTGGGAAGAATTTCAGG - Intergenic
1043467173 8:80522195-80522217 CTGACTTACAGTAAAATTTCAGG + Exonic
1043515206 8:80989692-80989714 CTGACCTTGAGTAGAACAGCGGG + Intronic
1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG + Intergenic
1047576690 8:126163566-126163588 TTAACCATGATTAAAATTTCAGG - Intergenic
1048254723 8:132896994-132897016 CTCACCTGGGGTAAAAGTTCTGG + Intronic
1050798795 9:9582319-9582341 CCGTCCCTAAGTAAAATTTCTGG + Intronic
1052253249 9:26424724-26424746 TTGTCCATGAGTGAAATTTCTGG - Intergenic
1053034517 9:34812951-34812973 GTGATCTTGAGGAAAATGTCAGG - Intergenic
1055610247 9:78015402-78015424 CTTACATAGAGCAAAATTTCTGG + Intronic
1057106078 9:92418420-92418442 CTGAACTTGAGTCAAAAGTCTGG + Intronic
1059166383 9:112080138-112080160 CAGACCATCAGTAACATTTCAGG - Exonic
1059843879 9:118249331-118249353 ATGACCTTGAATACAACTTCTGG + Intergenic
1060385717 9:123226416-123226438 GTGACCTTGAGGAAGATTTCTGG - Intronic
1061033361 9:128100101-128100123 CTGACCTTGTGTAAATGTTTAGG + Intronic
1187633782 X:21204683-21204705 CTGAACTTGAATCATATTTCAGG - Intergenic
1188827946 X:34859872-34859894 ATGACTTTGAGAAAATTTTCTGG + Intergenic
1195779844 X:108449967-108449989 CTGATGGTGAGTAAAATTACTGG + Intronic
1195901549 X:109802998-109803020 CTGCCCAGGAGTAAAATTGCTGG - Intergenic
1196233982 X:113257752-113257774 AACAACTTGAGTAAAATTTCAGG - Intergenic
1196708369 X:118737288-118737310 CTGACATTGATTGAAATTTATGG + Intronic
1197433319 X:126393628-126393650 CTCACCTTAAGTTAAAGTTCTGG - Intergenic
1197667520 X:129239859-129239881 CTGTCCTTGGATAAAACTTCAGG + Intergenic